ID: 912075830

View in Genome Browser
Species Human (GRCh38)
Location 1:105873827-105873849
Sequence AGAGCTTGGAATGCGTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075830_912075834 28 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075834 1:105873878-105873900 ATTGGCTATACACTGTCACAGGG No data
912075830_912075832 10 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data
912075830_912075833 27 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075833 1:105873877-105873899 TATTGGCTATACACTGTCACAGG No data
912075830_912075835 29 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075835 1:105873879-105873901 TTGGCTATACACTGTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075830 Original CRISPR AGAGCTTGGAATGCGTGCCT CGG (reversed) Intergenic
No off target data available for this crispr