ID: 912075831

View in Genome Browser
Species Human (GRCh38)
Location 1:105873841-105873863
Sequence TCTGAGTATGTGAGAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075831_912075832 -4 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data
912075831_912075834 14 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075834 1:105873878-105873900 ATTGGCTATACACTGTCACAGGG No data
912075831_912075833 13 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075833 1:105873877-105873899 TATTGGCTATACACTGTCACAGG No data
912075831_912075835 15 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075835 1:105873879-105873901 TTGGCTATACACTGTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075831 Original CRISPR TCTGAGTATGTGAGAGAGCT TGG (reversed) Intergenic