ID: 912075832

View in Genome Browser
Species Human (GRCh38)
Location 1:105873860-105873882
Sequence CAGACTTCACTCACTTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075830_912075832 10 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data
912075831_912075832 -4 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data
912075829_912075832 15 Left 912075829 1:105873822-105873844 CCACACCGAGGCACGCATTCCAA No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data
912075827_912075832 27 Left 912075827 1:105873810-105873832 CCACTTTCTGCTCCACACCGAGG No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data
912075826_912075832 28 Left 912075826 1:105873809-105873831 CCCACTTTCTGCTCCACACCGAG No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075832 Original CRISPR CAGACTTCACTCACTTTTAT TGG Intergenic
No off target data available for this crispr