ID: 912075833

View in Genome Browser
Species Human (GRCh38)
Location 1:105873877-105873899
Sequence TATTGGCTATACACTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075831_912075833 13 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075833 1:105873877-105873899 TATTGGCTATACACTGTCACAGG No data
912075830_912075833 27 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075833 1:105873877-105873899 TATTGGCTATACACTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075833 Original CRISPR TATTGGCTATACACTGTCAC AGG Intergenic
No off target data available for this crispr