ID: 912075835

View in Genome Browser
Species Human (GRCh38)
Location 1:105873879-105873901
Sequence TTGGCTATACACTGTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075830_912075835 29 Left 912075830 1:105873827-105873849 CCGAGGCACGCATTCCAAGCTCT No data
Right 912075835 1:105873879-105873901 TTGGCTATACACTGTCACAGGGG No data
912075831_912075835 15 Left 912075831 1:105873841-105873863 CCAAGCTCTCTCACATACTCAGA No data
Right 912075835 1:105873879-105873901 TTGGCTATACACTGTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075835 Original CRISPR TTGGCTATACACTGTCACAG GGG Intergenic
No off target data available for this crispr