ID: 912079227

View in Genome Browser
Species Human (GRCh38)
Location 1:105914020-105914042
Sequence TTATAGGCACAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912079227_912079233 3 Left 912079227 1:105914020-105914042 CCATCCCCATTCTGTGCCTATAA No data
Right 912079233 1:105914046-105914068 CCCAGAGTCAGCTGACAGAGAGG No data
912079227_912079235 17 Left 912079227 1:105914020-105914042 CCATCCCCATTCTGTGCCTATAA No data
Right 912079235 1:105914060-105914082 ACAGAGAGGAGACAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912079227 Original CRISPR TTATAGGCACAGAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr