ID: 912102869

View in Genome Browser
Species Human (GRCh38)
Location 1:106233528-106233550
Sequence AGAGGTTGTTAGAAGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912102869_912102871 -10 Left 912102869 1:106233528-106233550 CCTAGCTGCTTCTAACAACCTCT No data
Right 912102871 1:106233541-106233563 AACAACCTCTGCTCTAACATGGG No data
912102869_912102874 10 Left 912102869 1:106233528-106233550 CCTAGCTGCTTCTAACAACCTCT No data
Right 912102874 1:106233561-106233583 GGGATCTAGGAAATGACTTAAGG No data
912102869_912102873 -3 Left 912102869 1:106233528-106233550 CCTAGCTGCTTCTAACAACCTCT No data
Right 912102873 1:106233548-106233570 TCTGCTCTAACATGGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912102869 Original CRISPR AGAGGTTGTTAGAAGCAGCT AGG (reversed) Intergenic