ID: 912102871

View in Genome Browser
Species Human (GRCh38)
Location 1:106233541-106233563
Sequence AACAACCTCTGCTCTAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912102869_912102871 -10 Left 912102869 1:106233528-106233550 CCTAGCTGCTTCTAACAACCTCT No data
Right 912102871 1:106233541-106233563 AACAACCTCTGCTCTAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912102871 Original CRISPR AACAACCTCTGCTCTAACAT GGG Intergenic
No off target data available for this crispr