ID: 912102873

View in Genome Browser
Species Human (GRCh38)
Location 1:106233548-106233570
Sequence TCTGCTCTAACATGGGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912102869_912102873 -3 Left 912102869 1:106233528-106233550 CCTAGCTGCTTCTAACAACCTCT No data
Right 912102873 1:106233548-106233570 TCTGCTCTAACATGGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912102873 Original CRISPR TCTGCTCTAACATGGGATCT AGG Intergenic
No off target data available for this crispr