ID: 912102873 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:106233548-106233570 |
| Sequence | TCTGCTCTAACATGGGATCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912102869_912102873 | -3 | Left | 912102869 | 1:106233528-106233550 | CCTAGCTGCTTCTAACAACCTCT | No data | ||
| Right | 912102873 | 1:106233548-106233570 | TCTGCTCTAACATGGGATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912102873 | Original CRISPR | TCTGCTCTAACATGGGATCT AGG | Intergenic | ||