ID: 912102874 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:106233561-106233583 |
Sequence | GGGATCTAGGAAATGACTTA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912102872_912102874 | -8 | Left | 912102872 | 1:106233546-106233568 | CCTCTGCTCTAACATGGGATCTA | No data | ||
Right | 912102874 | 1:106233561-106233583 | GGGATCTAGGAAATGACTTAAGG | No data | ||||
912102869_912102874 | 10 | Left | 912102869 | 1:106233528-106233550 | CCTAGCTGCTTCTAACAACCTCT | No data | ||
Right | 912102874 | 1:106233561-106233583 | GGGATCTAGGAAATGACTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912102874 | Original CRISPR | GGGATCTAGGAAATGACTTA AGG | Intergenic | ||