ID: 912102875

View in Genome Browser
Species Human (GRCh38)
Location 1:106233582-106233604
Sequence GGTTGAAATTATATTTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912102872_912102875 13 Left 912102872 1:106233546-106233568 CCTCTGCTCTAACATGGGATCTA No data
Right 912102875 1:106233582-106233604 GGTTGAAATTATATTTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912102875 Original CRISPR GGTTGAAATTATATTTAAAC AGG Intergenic
No off target data available for this crispr