ID: 912102875 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:106233582-106233604 |
| Sequence | GGTTGAAATTATATTTAAAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912102872_912102875 | 13 | Left | 912102872 | 1:106233546-106233568 | CCTCTGCTCTAACATGGGATCTA | 0: 1 1: 0 2: 0 3: 11 4: 126 |
||
| Right | 912102875 | 1:106233582-106233604 | GGTTGAAATTATATTTAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912102875 | Original CRISPR | GGTTGAAATTATATTTAAAC AGG | Intergenic | ||