ID: 912105273

View in Genome Browser
Species Human (GRCh38)
Location 1:106265227-106265249
Sequence GATGAGGAAGACTGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912105263_912105273 29 Left 912105263 1:106265175-106265197 CCCACAGCAGCTGTACAACTGGC No data
Right 912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG No data
912105264_912105273 28 Left 912105264 1:106265176-106265198 CCACAGCAGCTGTACAACTGGCA No data
Right 912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG No data
912105271_912105273 -3 Left 912105271 1:106265207-106265229 CCACTCTGGTCTGGGGAGAGGAT No data
Right 912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG No data
912105269_912105273 0 Left 912105269 1:106265204-106265226 CCTCCACTCTGGTCTGGGGAGAG No data
Right 912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912105273 Original CRISPR GATGAGGAAGACTGCACAGC TGG Intergenic
No off target data available for this crispr