ID: 912107570

View in Genome Browser
Species Human (GRCh38)
Location 1:106299024-106299046
Sequence GAGGTTGAAATGAGTATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912107560_912107570 25 Left 912107560 1:106298976-106298998 CCACTTATATAAAGGCTGAACAG No data
Right 912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG No data
912107564_912107570 1 Left 912107564 1:106299000-106299022 CCAAGGGCAGACTGTAATTTTAG No data
Right 912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG No data
912107563_912107570 2 Left 912107563 1:106298999-106299021 CCCAAGGGCAGACTGTAATTTTA No data
Right 912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912107570 Original CRISPR GAGGTTGAAATGAGTATGGG GGG Intergenic
No off target data available for this crispr