ID: 912115269

View in Genome Browser
Species Human (GRCh38)
Location 1:106398955-106398977
Sequence GATGCTGGTAATACACATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912115269_912115271 27 Left 912115269 1:106398955-106398977 CCAAAATGTGTATTACCAGCATC No data
Right 912115271 1:106399005-106399027 AAACAATCTGATTTAGTGCAAGG No data
912115269_912115272 30 Left 912115269 1:106398955-106398977 CCAAAATGTGTATTACCAGCATC No data
Right 912115272 1:106399008-106399030 CAATCTGATTTAGTGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912115269 Original CRISPR GATGCTGGTAATACACATTT TGG (reversed) Intergenic
No off target data available for this crispr