ID: 912119578

View in Genome Browser
Species Human (GRCh38)
Location 1:106453975-106453997
Sequence TTTCATCTGGACCACGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912119572_912119578 25 Left 912119572 1:106453927-106453949 CCACACGCCAGCTTGGTGATACA No data
Right 912119578 1:106453975-106453997 TTTCATCTGGACCACGGTTTGGG No data
912119573_912119578 18 Left 912119573 1:106453934-106453956 CCAGCTTGGTGATACAGTGATGT No data
Right 912119578 1:106453975-106453997 TTTCATCTGGACCACGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912119578 Original CRISPR TTTCATCTGGACCACGGTTT GGG Intergenic
No off target data available for this crispr