ID: 912121603

View in Genome Browser
Species Human (GRCh38)
Location 1:106478828-106478850
Sequence AGAGATTCAACAAGTCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912121603_912121607 5 Left 912121603 1:106478828-106478850 CCCTAGAGACTTGTTGAATCTCT No data
Right 912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG No data
912121603_912121608 19 Left 912121603 1:106478828-106478850 CCCTAGAGACTTGTTGAATCTCT No data
Right 912121608 1:106478870-106478892 TGATATGGGCAATGAAATCCAGG No data
912121603_912121606 4 Left 912121603 1:106478828-106478850 CCCTAGAGACTTGTTGAATCTCT No data
Right 912121606 1:106478855-106478877 CCAAAATGCTGATGATGATATGG No data
912121603_912121609 25 Left 912121603 1:106478828-106478850 CCCTAGAGACTTGTTGAATCTCT No data
Right 912121609 1:106478876-106478898 GGGCAATGAAATCCAGGCTGAGG No data
912121603_912121610 28 Left 912121603 1:106478828-106478850 CCCTAGAGACTTGTTGAATCTCT No data
Right 912121610 1:106478879-106478901 CAATGAAATCCAGGCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912121603 Original CRISPR AGAGATTCAACAAGTCTCTA GGG (reversed) Intergenic