ID: 912121604

View in Genome Browser
Species Human (GRCh38)
Location 1:106478829-106478851
Sequence AAGAGATTCAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912121604_912121607 4 Left 912121604 1:106478829-106478851 CCTAGAGACTTGTTGAATCTCTT No data
Right 912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG No data
912121604_912121606 3 Left 912121604 1:106478829-106478851 CCTAGAGACTTGTTGAATCTCTT No data
Right 912121606 1:106478855-106478877 CCAAAATGCTGATGATGATATGG No data
912121604_912121608 18 Left 912121604 1:106478829-106478851 CCTAGAGACTTGTTGAATCTCTT No data
Right 912121608 1:106478870-106478892 TGATATGGGCAATGAAATCCAGG No data
912121604_912121609 24 Left 912121604 1:106478829-106478851 CCTAGAGACTTGTTGAATCTCTT No data
Right 912121609 1:106478876-106478898 GGGCAATGAAATCCAGGCTGAGG No data
912121604_912121610 27 Left 912121604 1:106478829-106478851 CCTAGAGACTTGTTGAATCTCTT No data
Right 912121610 1:106478879-106478901 CAATGAAATCCAGGCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912121604 Original CRISPR AAGAGATTCAACAAGTCTCT AGG (reversed) Intergenic