ID: 912121607

View in Genome Browser
Species Human (GRCh38)
Location 1:106478856-106478878
Sequence CAAAATGCTGATGATGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912121604_912121607 4 Left 912121604 1:106478829-106478851 CCTAGAGACTTGTTGAATCTCTT No data
Right 912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG No data
912121603_912121607 5 Left 912121603 1:106478828-106478850 CCCTAGAGACTTGTTGAATCTCT No data
Right 912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912121607 Original CRISPR CAAAATGCTGATGATGATAT GGG Intergenic
No off target data available for this crispr