ID: 912121607 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:106478856-106478878 |
Sequence | CAAAATGCTGATGATGATAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912121603_912121607 | 5 | Left | 912121603 | 1:106478828-106478850 | CCCTAGAGACTTGTTGAATCTCT | No data | ||
Right | 912121607 | 1:106478856-106478878 | CAAAATGCTGATGATGATATGGG | No data | ||||
912121604_912121607 | 4 | Left | 912121604 | 1:106478829-106478851 | CCTAGAGACTTGTTGAATCTCTT | No data | ||
Right | 912121607 | 1:106478856-106478878 | CAAAATGCTGATGATGATATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912121607 | Original CRISPR | CAAAATGCTGATGATGATAT GGG | Intergenic | ||