ID: 912122236

View in Genome Browser
Species Human (GRCh38)
Location 1:106485795-106485817
Sequence ATGGTAAAAGCTATACATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912122234_912122236 -1 Left 912122234 1:106485773-106485795 CCTTGGGAACTTTTCTGGGATAA No data
Right 912122236 1:106485795-106485817 ATGGTAAAAGCTATACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912122236 Original CRISPR ATGGTAAAAGCTATACATAT TGG Intergenic
No off target data available for this crispr