ID: 912128475

View in Genome Browser
Species Human (GRCh38)
Location 1:106570749-106570771
Sequence TGTTAGTAGTAGAAATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912128475_912128482 -5 Left 912128475 1:106570749-106570771 CCACCCAATTTCTACTACTAACA No data
Right 912128482 1:106570767-106570789 TAACAAGGGAGGGAATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912128475 Original CRISPR TGTTAGTAGTAGAAATTGGG TGG (reversed) Intergenic
No off target data available for this crispr