ID: 912129419

View in Genome Browser
Species Human (GRCh38)
Location 1:106583007-106583029
Sequence GGTAATTAGTCTATCACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912129416_912129419 -7 Left 912129416 1:106582991-106583013 CCCAAGACCAGAGTTGGGTAATT No data
Right 912129419 1:106583007-106583029 GGTAATTAGTCTATCACCATTGG No data
912129415_912129419 -6 Left 912129415 1:106582990-106583012 CCCCAAGACCAGAGTTGGGTAAT No data
Right 912129419 1:106583007-106583029 GGTAATTAGTCTATCACCATTGG No data
912129417_912129419 -8 Left 912129417 1:106582992-106583014 CCAAGACCAGAGTTGGGTAATTA No data
Right 912129419 1:106583007-106583029 GGTAATTAGTCTATCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912129419 Original CRISPR GGTAATTAGTCTATCACCAT TGG Intergenic
No off target data available for this crispr