ID: 912129774

View in Genome Browser
Species Human (GRCh38)
Location 1:106587077-106587099
Sequence TGGTGCCATATCGAGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912129764_912129774 26 Left 912129764 1:106587028-106587050 CCAATATAATCAAACTGCCACAA No data
Right 912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG No data
912129767_912129774 9 Left 912129767 1:106587045-106587067 CCACAAGGTAGCTGGCTGATCAC No data
Right 912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912129774 Original CRISPR TGGTGCCATATCGAGGGCTC AGG Intergenic
No off target data available for this crispr