ID: 912131776

View in Genome Browser
Species Human (GRCh38)
Location 1:106611869-106611891
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 798
Summary {0: 3, 1: 26, 2: 92, 3: 198, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912131772_912131776 29 Left 912131772 1:106611817-106611839 CCAGTGGTGGAGCAGTCAGAACA 0: 2
1: 5
2: 22
3: 27
4: 178
Right 912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG 0: 3
1: 26
2: 92
3: 198
4: 479
912131773_912131776 -7 Left 912131773 1:106611853-106611875 CCAATTAAGTTCATTGTCTTATA No data
Right 912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG 0: 3
1: 26
2: 92
3: 198
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
902165433 1:14567314-14567336 TCTTATATTGTTGTGGTTCATGG + Intergenic
902928284 1:19712240-19712262 TCTTATATGGACAATGTTTGTGG + Intronic
904115053 1:28155582-28155604 TCTTCAATGGACTTGGCTCACGG + Intronic
904665409 1:32116956-32116978 TCTTATATGACCATGGCTCATGG + Intronic
904670318 1:32159973-32159995 TCTTTTATAGACTTGGTCCAAGG + Intronic
904722639 1:32522139-32522161 TCTTATAAGGAATTGGCTCATGG - Intronic
904777012 1:32915876-32915898 TCTGATATGTGCGTGGTTCATGG + Intergenic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906269846 1:44468030-44468052 TCTTATATGAGTGTGGTTCATGG + Intronic
906558889 1:46739132-46739154 TCTTATATGGGTGTGGTTCCTGG + Intergenic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
907649566 1:56281942-56281964 TTTTATATGGATGAGGTTCATGG + Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909916118 1:81321668-81321690 TCTTACATGGATGTGGCTCATGG + Intronic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910918322 1:92315305-92315327 TTTTATGTGGGCTTGGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911833907 1:102591536-102591558 TCTTATTTGGAACTTGTTCAAGG - Intergenic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912731483 1:112110441-112110463 TCTTCTATGGGTGTGGTTCATGG + Intergenic
913097576 1:115534173-115534195 TCTTATCTTGTCATGCTTCAAGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913369406 1:118081678-118081700 TCTTATTAGCACATGGTACAGGG + Intronic
914776284 1:150738748-150738770 TCTTATATGCACGTGGCTCATGG - Intronic
916839923 1:168589108-168589130 TTTAATGTGGACATGTTTCAAGG - Intergenic
917950879 1:180034689-180034711 TCTTAAACGGACATGGTTGGTGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918632537 1:186735195-186735217 TCTTATATGGGAGTGGCTCATGG + Intergenic
918720012 1:187840769-187840791 TCTTATCTTGACATGGTGTAAGG - Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
918881912 1:190135291-190135313 TCTTTTATGGAAATGTTTCTGGG + Intronic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
920538364 1:206757409-206757431 TCTTATATGGACACAGTTTGTGG + Intergenic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922032454 1:221814776-221814798 TCTTATATGGACTCACTTCATGG - Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
922959244 1:229631715-229631737 ACTTACAAGGACACGGTTCATGG + Intronic
923763147 1:236866341-236866363 TCTTCTATGGGTGTGGTTCATGG - Intronic
924499861 1:244627216-244627238 TCTTATATGGTCGCAGTTCATGG + Intronic
924661830 1:246026631-246026653 TCTCATATGGGCACTGTTCATGG - Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062890238 10:1054020-1054042 TCTTATATAGGGGTGGTTCATGG + Intronic
1063247054 10:4232069-4232091 TCTCATATGGGCACAGTTCATGG - Intergenic
1063329483 10:5142692-5142714 TCTTATATGGGCACAGTTTAGGG + Intergenic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1064868622 10:19911146-19911168 TATTATATGGTCTTGGATCAAGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065699957 10:28415260-28415282 TCTTATATGGTATTGATTCATGG - Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1068268943 10:54694679-54694701 TCTTCTATGGACCTGGTTTGTGG - Intronic
1068398312 10:56493809-56493831 GTTTCTATGGACATGGATCAGGG - Intergenic
1068748701 10:60566150-60566172 TCTTATATGGATGTGGTTTGTGG - Intronic
1069398184 10:68012580-68012602 TCTTATATAGGTAAGGTTCATGG + Intronic
1070049551 10:72874166-72874188 TCAAATGTGTACATGGTTCAGGG + Intronic
1070315426 10:75306836-75306858 TCTTACAAGGGCGTGGTTCACGG - Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070420801 10:76235258-76235280 TCTTCTATGAGCATGATTCATGG + Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071663014 10:87524819-87524841 TCTTATATGGGTGGGGTTCATGG + Intronic
1072266429 10:93732693-93732715 TCTTATATTGACATTTTTAAAGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1073255806 10:102150383-102150405 TCCTATCTGAACATGGTCCAGGG + Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074210692 10:111331458-111331480 TCTTATATGGGTGTAGTTCATGG - Intergenic
1074905275 10:117856916-117856938 TGTTATATGGGTATGGCTCATGG + Intergenic
1075168234 10:120088645-120088667 TCTTCTATGGACAGGGTCCATGG - Intergenic
1075490729 10:122866682-122866704 TGTTATAGGGTCATGATTCATGG - Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1077803696 11:5568375-5568397 TCCTATATGGATATGCTTTAGGG - Intronic
1078784359 11:14473615-14473637 TTTTATATGGGAATGGTTCCTGG + Intronic
1079093057 11:17494177-17494199 CCTTATCTGGCCCTGGTTCAGGG + Intronic
1079540097 11:21562919-21562941 TCATCTGTGGACATGTTTCAAGG - Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1079832449 11:25285333-25285355 TCTTATAAAGTCATGGTTCATGG + Intergenic
1080412551 11:32039496-32039518 TACTATATGGATATGTTTCAAGG - Intronic
1080656865 11:34265177-34265199 TCTTATATGCTCAGGCTTCAAGG - Intronic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081387554 11:42490068-42490090 TCTCATATGGATATGAATCATGG + Intergenic
1081485743 11:43526853-43526875 TCTTATATGGGCACAGTTCGTGG + Intergenic
1082105711 11:48219104-48219126 TCGTCTATGGACAGGGTTAATGG - Intergenic
1082205354 11:49427097-49427119 TCTTATATGGATGTGGTTTGTGG - Intergenic
1082686703 11:56246721-56246743 TCCTATATGGGCACAGTTCATGG + Intergenic
1083135178 11:60666885-60666907 TCTTATATAGACACAGTTTATGG - Intergenic
1083135193 11:60667146-60667168 TCTTATATAGACACAGTTTATGG - Intergenic
1083164264 11:60873859-60873881 ACTTATATGGACAAAGTTCTGGG + Intronic
1084137710 11:67199123-67199145 TCCTATATGGATACAGTTCATGG - Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1084668161 11:70588045-70588067 TCTTATATGGGTACAGTTCATGG - Intronic
1085270447 11:75266971-75266993 TCCTAAATGGACATGTTTCATGG - Intronic
1086032643 11:82378748-82378770 TATTAAAGGGACATTGTTCAAGG - Intergenic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086649751 11:89273439-89273461 TCTTATATGGATGTGGTTTGTGG + Intronic
1086734262 11:90286156-90286178 TCTTTTATGGACATAGTTCGTGG + Intergenic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089187623 11:116630685-116630707 TCTTATATGGACACCAGTCATGG + Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091821664 12:3480050-3480072 TCTTCCATGGACATGGATAATGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1092727441 12:11499613-11499635 TCATGTATGGACAGGGTTCTTGG + Intronic
1092734424 12:11566989-11567011 TGTTATATGGACATACTGCATGG + Intergenic
1093427530 12:19045300-19045322 TATTATATGGGCATAGCTCATGG - Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1094524619 12:31223298-31223320 TCGTGTATGGACAGGGTTCCTGG - Intergenic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1097758450 12:63433755-63433777 TGTTATAGGGGAATGGTTCATGG - Intergenic
1097922358 12:65090022-65090044 CCTTAAATGGACATGGTAAAAGG - Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1098921784 12:76309258-76309280 TCTTCTACGGGCATGGATCATGG + Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1099218345 12:79880995-79881017 TCTTCTATGAATATGGTTCATGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1100241918 12:92718265-92718287 CCTGATATGGGCATGGTGCAAGG + Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101226117 12:102689731-102689753 TATTATATGGACATAAGTCATGG + Intergenic
1102297606 12:111749033-111749055 TCTTACTGGGACATGGTTAAAGG - Intronic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104991949 12:132630078-132630100 TCTTCTATGCGCACGGTTCATGG + Intronic
1105780048 13:23697639-23697661 TCTTATATGGGGTTAGTTCATGG - Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1107257893 13:38452449-38452471 ACTGATATGGGCATAGTTCATGG - Intergenic
1107271668 13:38626133-38626155 TATTAAATGGAGATGGCTCAGGG + Intergenic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1107982978 13:45751105-45751127 TCTTCTAGGGCCATGTTTCAGGG + Intergenic
1107988423 13:45796313-45796335 TGTTAAATGGACATATTTCATGG + Intronic
1108181398 13:47843376-47843398 CCATCTATGGGCATGGTTCATGG + Intergenic
1108331698 13:49391543-49391565 TCTTTTATAGACTTTGTTCAAGG + Intronic
1108467958 13:50737610-50737632 TCTTCTATGGGCATGGCTTATGG - Intronic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109927117 13:69158216-69158238 TTTTATATGGATGTGGGTCATGG - Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1111163555 13:84427246-84427268 TCTTATATAAGCATGGTTCCTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1112043399 13:95571096-95571118 TCTAAAATGAACATGTTTCAAGG - Intronic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112978902 13:105356679-105356701 TCTTCTAAGGTCATGGTTCATGG - Intergenic
1113045146 13:106147408-106147430 TCTTATATGGCCAGGGCACAAGG + Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113487040 13:110661876-110661898 TCTTCCATGGATGTGGTTCATGG + Intronic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113648976 13:112020703-112020725 TCCTGTATGGGCATGGTTTATGG - Intergenic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115740789 14:36385713-36385735 TTTTATATGGGCACAGTTCATGG - Intergenic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1116322239 14:43483001-43483023 TCTTTTTTGGACATGAGTCAGGG + Intergenic
1116499476 14:45602755-45602777 TTCTATATGGACATCATTCATGG + Intergenic
1116607184 14:47015157-47015179 TCTTTTATGGGTGTGGTTCATGG + Intronic
1117231239 14:53720975-53720997 TCTTATATGGGCACAGTTCGTGG - Intergenic
1117245055 14:53876318-53876340 TCTTTAATGGACAGGGTACAGGG - Intergenic
1117269569 14:54128401-54128423 TCTTATATGGGTATGATACATGG - Intergenic
1117622218 14:57599195-57599217 ACTTATATGGATAGGGTTCCAGG + Intronic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1117932304 14:60855853-60855875 TCTTATATGGGTGTGGTTCCTGG - Intronic
1118518062 14:66548505-66548527 TATTATATGGACACAGTTCATGG - Intronic
1118527014 14:66656727-66656749 TGTTCTATGGATGTGGTTCATGG - Intronic
1118653238 14:67920461-67920483 TCTTATATAAATATGGTTTATGG + Intronic
1119912496 14:78362687-78362709 TGTTTTAAGGATATGGTTCATGG + Intronic
1120174986 14:81284025-81284047 TCTTATATGGGCACAGTTTATGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1120592568 14:86392955-86392977 TCTTATATGAATATGGTTTGTGG + Intergenic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121461458 14:94081747-94081769 TCTTATATGGGCACAGCTCATGG - Intronic
1121594410 14:95148678-95148700 TCTTATATGGAGATCTTTGATGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122522702 14:102356789-102356811 TTATATATGCACATGGTTCATGG - Intronic
1122993873 14:105252071-105252093 TCTTGTGTGGACAAGGTTTAAGG - Intronic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1124367687 15:29085162-29085184 TCTTATATGAACAATATTCAGGG - Intronic
1124397157 15:29312646-29312668 CCTTATATGGGCACAGTTCATGG - Intronic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1124901580 15:33828167-33828189 TCTTACAAGGGCATAGTTCATGG - Intronic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1125870618 15:43098228-43098250 TCTTTTATGGATGTGGTTCATGG + Intronic
1125981349 15:44004572-44004594 TCTTCTATGGGCATGGCTTATGG - Intronic
1126714271 15:51497644-51497666 TCTTTTATGCACATAGTTCAGGG - Intronic
1126939348 15:53749380-53749402 TCTTATATGGGCATAATTTATGG - Intronic
1127025441 15:54800156-54800178 TCTTATATAGGCAAGGTTCGTGG - Intergenic
1127307592 15:57723329-57723351 TCTGATAGGGGAATGGTTCATGG - Intronic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1127600383 15:60529979-60530001 TCTTAAATGGACAGGGTTCTAGG - Intronic
1128010253 15:64287696-64287718 TCTTTTATGAAGATGGTTAAAGG + Intronic
1128189954 15:65682928-65682950 TCTTATATGGGAACAGTTCATGG + Intronic
1128424502 15:67526430-67526452 TATTATATGGACTTGGCTCCTGG + Exonic
1128866360 15:71117605-71117627 TGTAATTTGGACATGGTTGAAGG - Intronic
1128969476 15:72094894-72094916 TCTTATATGGTCATGATTTTTGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129499290 15:76020106-76020128 TCTTACACAGTCATGGTTCATGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130168208 15:81484786-81484808 TCTTATAAGGACATGGCTGCTGG - Intergenic
1131169738 15:90169090-90169112 TCTTGTATGGGCCCGGTTCATGG + Intronic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1131974168 15:97926102-97926124 TATTATAGGGACACAGTTCATGG + Intergenic
1132382940 15:101379214-101379236 TGGAATATGGCCATGGTTCAGGG - Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1135293040 16:21256576-21256598 TGTTACAGGAACATGGTTCAGGG - Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136611144 16:31366313-31366335 TCATATACGGACGTGCTTCATGG - Intronic
1137234136 16:46599473-46599495 TCTTTTATGGATGTGGTTCATGG + Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141065462 16:80910198-80910220 CTTAATAAGGACATGGTTCAGGG - Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141349636 16:83282168-83282190 TCTTCTGCGGACATGGCTCATGG + Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146115510 17:30134218-30134240 TTTTATCTGGGCATGGTACATGG + Intronic
1146158361 17:30543783-30543805 TCTTAGATGGGCACAGTTCATGG - Intergenic
1146538735 17:33676116-33676138 TTTTATATGGATGTGGCTCATGG - Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149192085 17:54075082-54075104 TTTTATATGGGCAAGGGTCATGG - Intergenic
1149299404 17:55290511-55290533 TCTTATATGGGTGTGGCTCATGG - Intronic
1149378112 17:56065721-56065743 TCTCATATAGTGATGGTTCATGG + Intergenic
1153181534 18:2440738-2440760 TCTTATATGGATGCAGTTCATGG + Intergenic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153491258 18:5650527-5650549 TCTTATATGGATGCAGTTCATGG - Intergenic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1153721581 18:7908880-7908902 TCTAATATGCACAAAGTTCATGG + Intronic
1154096649 18:11422864-11422886 TCTCATATGGGCACGGTTAATGG + Intergenic
1154220123 18:12445264-12445286 TCTTATATGGGCACAGGTCATGG + Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155580226 18:27296751-27296773 TCTTATATGGGGACTGTTCATGG + Intergenic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156579791 18:38361751-38361773 TTTCATATGGGGATGGTTCATGG + Intergenic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1158212076 18:55062764-55062786 TCTTATACAGGCCTGGTTCATGG + Intergenic
1158250638 18:55483584-55483606 TCTTATATGGTCATTGTAAAGGG + Intronic
1158494520 18:57942455-57942477 TCTTATACTGACATGATACAAGG + Intergenic
1159180607 18:64897869-64897891 TTTTATATGGTCATGATTCATGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160355752 18:78226991-78227013 TCTTACAAGGACATCGGTCATGG + Intergenic
1162843745 19:13375233-13375255 TCTTCTATGGATGTGGTTCGTGG - Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1165599634 19:37043036-37043058 TCGTATAGGGACCTGATTCATGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1166580183 19:43890268-43890290 TCTTATATGGGTGTGGCTCACGG + Intronic
1167626824 19:50595833-50595855 TCTGATATGGATGTGGTTCATGG - Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926449973 2:12991131-12991153 TTTTATATGGACATGCTTCCTGG - Intergenic
926608438 2:14921263-14921285 TCTTATATGAGTGTGGTTCATGG + Intergenic
926818585 2:16827118-16827140 TCTTGTATGGGCACAGTTCATGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930471686 2:51823909-51823931 GCTCATATGGGCAAGGTTCATGG - Intergenic
930800299 2:55436932-55436954 TGTTATATGGATGTGGTTTATGG + Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
931883763 2:66593530-66593552 TCTTATATGAAACTGGTTCCTGG + Intergenic
931924857 2:67060971-67060993 TCTTATATGAGTGTGGTTCATGG + Intergenic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933548935 2:83749566-83749588 TCTTATTTAGGCATGATTCATGG - Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936719782 2:115237318-115237340 TTTTATACTGACATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937796666 2:126030620-126030642 TCCTATATGGATATGGTTTGTGG + Intergenic
938396349 2:130951536-130951558 TCTTCTATGGGCACAGTTCATGG + Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938960617 2:136337322-136337344 TCTTATATGAGCACAGTTCATGG - Intergenic
939186046 2:138861869-138861891 TTTTATATGGATGTGGTTTATGG + Intergenic
939285462 2:140123386-140123408 TCATATATGGGTGTGGTTCATGG + Intergenic
940037474 2:149325967-149325989 TCTTATCTGGACACGGTCCATGG + Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941733020 2:168939947-168939969 TCTTATATTGGCGTGGTTCGTGG - Intronic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942258981 2:174138411-174138433 TCTTCTATGTGCATCGTTCATGG + Intronic
942747780 2:179255023-179255045 TCTTATATGGGTTTGATTCATGG - Intronic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943169194 2:184374331-184374353 TCTTATATGAGGATGATTCATGG - Intergenic
943247004 2:185467459-185467481 TCTTAAAGGGGCATAGTTCATGG + Intergenic
943531658 2:189089805-189089827 TCTTGTATGGGCATCATTCAAGG - Intronic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
944063024 2:195589534-195589556 TCTTCTATTGACATGGGTGATGG + Intronic
944079611 2:195772004-195772026 TCTTGTGTGGAGATGGATCATGG - Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948128711 2:235584320-235584342 TCTTATAGGAACAAGGTTAAGGG + Intronic
1169750797 20:8991349-8991371 TCTTTTATGGGCATGGGTCTTGG + Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170642695 20:18169513-18169535 TCTCATATGGGTGTGGTTCATGG - Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174326756 20:49785345-49785367 CCTAACATGTACATGGTTCATGG - Intergenic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1176350615 21:5792865-5792887 GCTCATATGGACATTGTACATGG - Intergenic
1176357429 21:5913449-5913471 GCTCATATGGACATTGTACATGG - Intergenic
1176544936 21:8190935-8190957 GCTCATATGGACATTGTACATGG - Intergenic
1176563887 21:8373980-8374002 GCTCATATGGACATTGTACATGG - Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1177167627 21:17620404-17620426 TCTTGTATGGGTGTGGTTCATGG + Intergenic
1177286296 21:19055685-19055707 TCTTATATGAGCATATTTCATGG - Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178519443 21:33275871-33275893 TCTTATATAGGTGTGGTTCATGG + Intronic
1179429190 21:41307762-41307784 TCTTCTGTGGACACTGTTCATGG + Intronic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1180887760 22:19259615-19259637 TCTTATATGTGTGTGGTTCATGG - Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1184825400 22:46947241-46947263 TGTTGTTTGGACATGGTTCTTGG + Intronic
1185177995 22:49341185-49341207 TCTTATGTGGTCATAGTACATGG - Intergenic
1203249806 22_KI270733v1_random:107173-107195 GCTCATATGGACATTGTACATGG - Intergenic
949306565 3:2648526-2648548 TCTTATATGGGTGCGGTTCATGG - Intronic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
949456983 3:4249519-4249541 TCTTATATGGACGTGATTTGTGG - Intronic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
951042969 3:18008527-18008549 TCTTATGTGGACACAGCTCATGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951507002 3:23458315-23458337 TCTTCTATGGGTGTGGTTCATGG + Intronic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953367211 3:42355323-42355345 TCTTCTATGGGTGTGGTTCATGG - Intergenic
953445708 3:42963897-42963919 TCTTATATGGATGAGGGTCATGG - Intronic
954944591 3:54409319-54409341 TTTTATATGGGTGTGGTTCATGG - Intronic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955448415 3:59038702-59038724 TCTTATATGGGGTTTGTTCATGG - Intronic
955925074 3:63996404-63996426 TTTCATGTGGACATTGTTCACGG - Exonic
956406827 3:68936640-68936662 TCTTACGTGGACATGTTGCATGG - Intergenic
956706827 3:72006277-72006299 TGTTATATTGTCATGCTTCAAGG - Intergenic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957627060 3:82666781-82666803 TCTTATATGGGCAAAGTTCCTGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
958971953 3:100621049-100621071 CTTTACATGGACGTGGTTCACGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959585593 3:108022339-108022361 TCATACATTGACATGGTTCCAGG + Intergenic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960258873 3:115542114-115542136 TCTTATATGGGCGCTGTTCATGG + Intergenic
960439187 3:117665894-117665916 TCTTATATTTATATGGTTCTAGG + Intergenic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963550005 3:146708002-146708024 TCTTATATAGGCACAGTTCATGG + Intergenic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964452833 3:156828048-156828070 GCTTATGTTGACATGGTTAATGG + Intronic
964535007 3:157711186-157711208 TCTTACATGGATGTAGTTCATGG - Intergenic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964870389 3:161307453-161307475 TCTTATACGGTCACAGTTCATGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
964942165 3:162171972-162171994 CCTTATATGGGCCTGATTCATGG - Intergenic
965352254 3:167628064-167628086 TCTTGTATGGGTGTGGTTCATGG - Intronic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
965998771 3:174920979-174921001 TCTCACATGGTCATGGTCCATGG + Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
967485379 3:190024050-190024072 TATAATAAGGACATGGTGCATGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
970219676 4:13797836-13797858 TCTTCTATGGACATGGGGGATGG + Intergenic
970394615 4:15654375-15654397 ACTTTTGTGGAGATGGTTCAGGG - Intronic
970504234 4:16710822-16710844 TATTATTGGGAGATGGTTCAGGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970884638 4:20973862-20973884 TCTTACATGGATGTAGTTCATGG + Intronic
971044091 4:22785434-22785456 TATTATATGTGCTTGGTTCATGG + Intergenic
971164191 4:24165722-24165744 TCTTATATGGTAATGGATCATGG - Intergenic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
972204213 4:36752225-36752247 TCTTATAGGAAGAAGGTTCAAGG - Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973737749 4:53889176-53889198 CCTTATGTGGACATGGGACATGG - Intronic
974212066 4:58791042-58791064 TCTTATATGAGCATGGCTTATGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974448702 4:62021777-62021799 TCTTATATGGGTGAGGTTCATGG - Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976154457 4:82127602-82127624 TCTTATATGGGCTAGGTTCCTGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977225826 4:94390425-94390447 TCTTATAAGGGCACAGTTCATGG + Intergenic
977314338 4:95426274-95426296 TCTTATATGAGTGTGGTTCATGG - Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977546920 4:98394466-98394488 CCTTATATGGACATACTACATGG - Intronic
977597073 4:98895068-98895090 TCTTATATCGCCAATGTTCATGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978018724 4:103782036-103782058 TCTCATATGGGCATGACTCATGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978308728 4:107361966-107361988 TCTTATAAGGGCACAGTTCATGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
979877289 4:125909326-125909348 TCATATATTGACATACTTCAAGG + Intergenic
979973817 4:127170791-127170813 TCTTATGTGGACACAATTCATGG - Intergenic
980065397 4:128182481-128182503 TCTTATCCTGGCATGGTTCATGG - Intronic
980374697 4:131929097-131929119 TCTTATATAGATGTGGTTCATGG + Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
981191403 4:141869060-141869082 TCTTATATGGATGCGGTTTATGG + Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982148217 4:152421866-152421888 TCTTCTATGGGTGTGGTTCATGG + Intronic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983154767 4:164333530-164333552 TCTTATGTGGGCACAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984461079 4:180037612-180037634 TCTTATATGGTCACAGTTCTTGG - Intergenic
984545187 4:181092862-181092884 TCTTATATGGAAGCAGTTCATGG + Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
985828340 5:2209318-2209340 TCCTATATCGATATGGTTCCTGG - Intergenic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989708881 5:44372361-44372383 TCTTATAAGGACATTTGTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990732218 5:58821731-58821753 ACTTAGATGTACTTGGTTCAGGG + Intronic
990788756 5:59453170-59453192 TCTTATATAGGCATGGCTTATGG - Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
991698468 5:69295829-69295851 GCTTATATGGACAATGTTTAGGG - Intronic
991936248 5:71803708-71803730 TCTTATAGGAACGTGGTTCTTGG + Intergenic
992074548 5:73178957-73178979 TCTTATATGAGCAAGGTTGATGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992922219 5:81537718-81537740 TCTTGTATGGGTGTGGTTCACGG - Intronic
993281668 5:85933115-85933137 TTGTATTTGGAAATGGTTCAAGG + Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994476082 5:100271927-100271949 TCTTATATGGACACAGCTCGTGG - Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994900741 5:105765406-105765428 TCTTATATGGTCGCGGTTCATGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995355531 5:111233522-111233544 TTTGATATGAACATTGTTCACGG - Intronic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995670094 5:114593426-114593448 TCTTATATGGGTGTGCTTCATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996482941 5:123996129-123996151 TTTTATATGGTCGTGGTACATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996660400 5:125996153-125996175 TGTTATAAGGACATGGTTTATGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
997176201 5:131780684-131780706 TCTTATATGGGCACAGTTCCTGG - Intronic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000131889 5:158308074-158308096 TCTTATAATGAAATGGTTCTTGG + Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1003275070 6:4643442-4643464 TCTTCTATGGGCATAGTTCGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004270828 6:14193597-14193619 TCTTATAAGGACAGGTTGCAGGG + Intergenic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1005402245 6:25446961-25446983 TCTTATATGGGTGTGATTCATGG + Intronic
1006075075 6:31527217-31527239 TCTTATATGAGCATCGCTCATGG + Intergenic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1008299105 6:49812391-49812413 TCTTATATGGGTGTGGTCCATGG + Intergenic
1008516301 6:52322607-52322629 TCTTGTATGAGCATGGCTCATGG + Intergenic
1008622500 6:53284879-53284901 TCTTATATAGGTGTGGTTCATGG - Intronic
1008975172 6:57417621-57417643 TCTTATAGGGGCATAGTTGATGG + Intronic
1009164057 6:60319140-60319162 TCTTATAGGGGCATAGTTGATGG + Intergenic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010964318 6:82186087-82186109 ACTTGTATGGATGTGGTTCATGG - Intronic
1011019783 6:82799614-82799636 TCTTGTATGGATGTGGCTCATGG - Intergenic
1011069829 6:83368139-83368161 TCTTATATGGGAGCGGTTCATGG + Intronic
1012044774 6:94258852-94258874 TATTATATGGAAATGGCTCTTGG + Intergenic
1012084144 6:94802030-94802052 TCTCATATGGACACAGTTCTTGG - Intergenic
1012304525 6:97636443-97636465 TCTTCTATAGGCATGGTTCGTGG - Intergenic
1012965077 6:105665347-105665369 TCTTCTATGTGCACGGTTCATGG + Intergenic
1013266478 6:108504462-108504484 TCTTATAAGGATGTGGTTCGTGG + Intronic
1013381868 6:109581058-109581080 TCTTATATAGATGTGGTTCATGG - Intronic
1013477565 6:110522954-110522976 TCTCATATGGCAATGTTTCATGG - Intergenic
1013712832 6:112921438-112921460 TCTTATACGGGCACAGTTCATGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014294211 6:119598483-119598505 TCTAATATGGGTGTGGTTCATGG + Intergenic
1014319597 6:119910462-119910484 TCTCATATGGGTATAGTTCAAGG - Intergenic
1014419197 6:121219940-121219962 TCTTATCTGGATACAGTTCATGG - Intronic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016175674 6:141075289-141075311 ACTTTTATGGACATGGATCATGG - Intergenic
1016199424 6:141389561-141389583 TCTTATATGAGCACAGTTCATGG + Intergenic
1016234636 6:141848600-141848622 TCATACAAGGACAAGGTTCATGG - Intergenic
1016571955 6:145523553-145523575 ATTTATATGGGTATGGTTCATGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016890354 6:149000214-149000236 TCTTATAAGGGCATAGTTCCAGG - Intronic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1016931492 6:149415297-149415319 CCTTAGATGGATATGCTTCATGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017337176 6:153275160-153275182 TCTTATATGGAAATAGTTGCTGG + Intergenic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018271470 6:162082869-162082891 TCTCATATGGGTGTGGTTCATGG + Intronic
1019507408 7:1399246-1399268 TCTGATCTGGTCTTGGTTCATGG - Intergenic
1019516767 7:1443600-1443622 TCTTCTAAGGACATGGTTGTTGG - Intronic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020459660 7:8414455-8414477 TCTTATACAGGCATGGGTCATGG - Intergenic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1021829867 7:24594666-24594688 TCTTATATGGGGGTGATTCATGG + Intronic
1022214193 7:28242085-28242107 ACTTATTTGGATATGCTTCAGGG - Intergenic
1022340628 7:29464069-29464091 TCTTATGTGTGCATTGTTCAGGG + Intronic
1022548899 7:31217730-31217752 TTTTATATGGGTGTGGTTCATGG + Intergenic
1023026067 7:36050878-36050900 TCTTATATGGGTGCGGTTCATGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1026507719 7:70999977-70999999 TCTTATATGAGTATGGCTCATGG - Intergenic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1027945011 7:84733413-84733435 TCTTATATTGGCGTGGTCCATGG + Intergenic
1028300091 7:89188285-89188307 TTCTATATGAACATGGTTCTTGG - Intronic
1028372370 7:90107703-90107725 TCTGATATGGGCATAGCTCATGG + Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028829402 7:95311019-95311041 TCTTAGATGCACTTGATTCAGGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030213789 7:107022487-107022509 AATGATATGGACAGGGTTCAGGG - Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031057316 7:117006895-117006917 TCTTATATGGATGTGGTTTGCGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031954760 7:127931038-127931060 TCTTATATGACTGTGGTTCATGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032379050 7:131456730-131456752 TCATATATGGACATGATTCTTGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033358898 7:140623873-140623895 CCTTATATTGACATGGATGAAGG + Intronic
1033393845 7:140955384-140955406 TCTTATATGGGCGCAGTTCATGG - Intergenic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034404446 7:150892910-150892932 TCTTACACGGGCATGGCTCACGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1036618043 8:10403942-10403964 TCTTAAATGCTCATGGGTCACGG - Intronic
1037218554 8:16488026-16488048 TCTTATATGGGTACAGTTCATGG + Intronic
1037263365 8:17032955-17032977 TCTTATATGGGTGCGGTTCATGG - Intronic
1037327835 8:17711967-17711989 TCTTAGATGAGCATGGTCCATGG + Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1037435633 8:18860234-18860256 CGTTATATGGGCATGGTTTATGG + Intronic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039556169 8:38476758-38476780 TTTTATATGGGTATGATTCATGG - Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040068118 8:43165281-43165303 TCTTATACAGGCAGGGTTCATGG - Intronic
1040076079 8:43232496-43232518 TCTTCTATGGGCACAGTTCATGG + Intergenic
1040441259 8:47445355-47445377 TCCTATATGGCCACGGTTCATGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042154198 8:65824271-65824293 TGTTATGTGGACAAGTTTCATGG - Intronic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043173144 8:76990669-76990691 TCTTATATGGATACAGTTCTTGG + Intronic
1043173150 8:76990719-76990741 TCTTATATGGATACAGTTCGTGG + Intronic
1043275711 8:78389648-78389670 TCCCATATGGGCATGATTCATGG - Intergenic
1043494041 8:80780602-80780624 TCTTATAAGGACATTTGTCATGG - Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043944771 8:86237604-86237626 TCTTATATGGGCACAGATCATGG + Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044089791 8:87985068-87985090 TCTTATACAGACATAGTCCATGG + Intergenic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1046400624 8:113699166-113699188 TTATATATTGACATGGTTCTGGG + Intergenic
1046844671 8:118902628-118902650 TCTAATATTGACATGGCTGATGG + Intergenic
1047034520 8:120922475-120922497 TTTTATATGGGAGTGGTTCATGG + Intergenic
1047576963 8:126166714-126166736 TCTCATATGGGCATGGCTTATGG + Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1049629138 8:143642769-143642791 TCTTATATGGGTGCGGTTCATGG + Intronic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050336925 9:4598218-4598240 TATTTTATGGGCATGTTTCATGG - Intronic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1050699456 9:8322064-8322086 TGTCTTATGGTCATGGTTCATGG - Intronic
1050706591 9:8406283-8406305 TTCTGTGTGGACATGGTTCAAGG - Intronic
1050792575 9:9492930-9492952 TCTTATATGGGTTGGGTTCATGG - Intronic
1050946558 9:11528203-11528225 CCTAATATGGACTAGGTTCAAGG + Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051454435 9:17238424-17238446 TCTTTTATGACCATGCTTCATGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051613588 9:18985197-18985219 TCTTATACGGGCGTGGCTCATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052037454 9:23698909-23698931 TATTATCTGGACAGGGATCATGG + Intronic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1053766409 9:41406040-41406062 TCATATATGGATGTGGTTCATGG - Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1055039533 9:71854369-71854391 TCTTATATGAGCGTGTTTCATGG + Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057504491 9:95621501-95621523 TCTTTTATTGGAATGGTTCATGG - Intergenic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058260871 9:102829716-102829738 TGTTATGTGGGCATGGCTCATGG - Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059558892 9:115311722-115311744 TCTTATATGAGCTTGATTCATGG - Intronic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061920711 9:133780840-133780862 TCTGTTTTGGACATGGATCATGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185523260 X:757719-757741 ACTTATTTTGCCATGGTTCATGG + Intergenic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186869487 X:13756349-13756371 TCTTAGAAGGACTTGCTTCATGG + Intronic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187474470 X:19598766-19598788 TCTTATATGGGCACAGTTTATGG + Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187811152 X:23178977-23178999 TATTATGTGTACATGGTGCACGG + Intergenic
1187814950 X:23221473-23221495 TCTTATATGGGCACTGCTCATGG + Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188432648 X:30122507-30122529 TCTTATGTAGGCATAGTTCATGG - Intergenic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189263715 X:39697294-39697316 TCTTATGTGGTCACAGTTCATGG + Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190141940 X:47854720-47854742 TCTTCTATGCGCATGGTTCGTGG + Intronic
1190420972 X:50283958-50283980 TCTTTTATAGACTTTGTTCAAGG - Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193396137 X:80985755-80985777 ACTTACATGGACACGGTTCGTGG + Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194779156 X:98002004-98002026 TCTTATATGGTCTTGTTTTATGG - Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1198673118 X:139102947-139102969 TCTTATATTTACATGGATCTAGG - Intronic
1198676101 X:139132903-139132925 TCTTCTATGGCCATAGGTCAAGG + Intronic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1200272039 X:154695103-154695125 TCTTAGAAGGACAATGTTCAAGG - Intronic
1200514126 Y:4120666-4120688 TTTTATATGGGTGTGGTTCATGG + Intergenic
1201509600 Y:14744351-14744373 TGGTATAAGGACATGGGTCATGG - Intronic
1201848794 Y:18453473-18453495 TCTTAGAAGGACTTGCTTCATGG - Intergenic
1201861648 Y:18604360-18604382 TCTTAGAAGGACTTGATTCATGG - Intergenic
1201871675 Y:18716020-18716042 TCTTAGAAGGACTTGATTCATGG + Intergenic
1201884524 Y:18866902-18866924 TCTTAGAAGGACTTGCTTCATGG + Intergenic