ID: 912135525

View in Genome Browser
Species Human (GRCh38)
Location 1:106656327-106656349
Sequence CACATGTCAGAGGCCTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912135525_912135535 18 Left 912135525 1:106656327-106656349 CCCATGAAGGCCTCTGACATGTG No data
Right 912135535 1:106656368-106656390 TTGTTTTGGGGATTAACATTTGG No data
912135525_912135529 4 Left 912135525 1:106656327-106656349 CCCATGAAGGCCTCTGACATGTG No data
Right 912135529 1:106656354-106656376 AGATGTTTTCCCCATTGTTTTGG No data
912135525_912135530 5 Left 912135525 1:106656327-106656349 CCCATGAAGGCCTCTGACATGTG No data
Right 912135530 1:106656355-106656377 GATGTTTTCCCCATTGTTTTGGG No data
912135525_912135531 6 Left 912135525 1:106656327-106656349 CCCATGAAGGCCTCTGACATGTG No data
Right 912135531 1:106656356-106656378 ATGTTTTCCCCATTGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912135525 Original CRISPR CACATGTCAGAGGCCTTCAT GGG (reversed) Intergenic