ID: 912137584

View in Genome Browser
Species Human (GRCh38)
Location 1:106680634-106680656
Sequence CGTCCACCCAGAAGCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912137584_912137590 11 Left 912137584 1:106680634-106680656 CCCTGGTGGCTTCTGGGTGGACG No data
Right 912137590 1:106680668-106680690 GTTTAATCAGGAGCCTAATTAGG No data
912137584_912137591 14 Left 912137584 1:106680634-106680656 CCCTGGTGGCTTCTGGGTGGACG No data
Right 912137591 1:106680671-106680693 TAATCAGGAGCCTAATTAGGAGG No data
912137584_912137589 -1 Left 912137584 1:106680634-106680656 CCCTGGTGGCTTCTGGGTGGACG No data
Right 912137589 1:106680656-106680678 GATGGGTTGGTAGTTTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912137584 Original CRISPR CGTCCACCCAGAAGCCACCA GGG (reversed) Intergenic
No off target data available for this crispr