ID: 912137591

View in Genome Browser
Species Human (GRCh38)
Location 1:106680671-106680693
Sequence TAATCAGGAGCCTAATTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912137585_912137591 13 Left 912137585 1:106680635-106680657 CCTGGTGGCTTCTGGGTGGACGA No data
Right 912137591 1:106680671-106680693 TAATCAGGAGCCTAATTAGGAGG No data
912137584_912137591 14 Left 912137584 1:106680634-106680656 CCCTGGTGGCTTCTGGGTGGACG No data
Right 912137591 1:106680671-106680693 TAATCAGGAGCCTAATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912137591 Original CRISPR TAATCAGGAGCCTAATTAGG AGG Intergenic
No off target data available for this crispr