ID: 912141603

View in Genome Browser
Species Human (GRCh38)
Location 1:106736774-106736796
Sequence GCTATGTGCACAGTCCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912141595_912141603 25 Left 912141595 1:106736726-106736748 CCTGCTGTGTGAAGACTCTGATT No data
Right 912141603 1:106736774-106736796 GCTATGTGCACAGTCCTCATGGG No data
912141594_912141603 26 Left 912141594 1:106736725-106736747 CCCTGCTGTGTGAAGACTCTGAT No data
Right 912141603 1:106736774-106736796 GCTATGTGCACAGTCCTCATGGG No data
912141598_912141603 -6 Left 912141598 1:106736757-106736779 CCCAGGGTATAGCCTCCGCTATG No data
Right 912141603 1:106736774-106736796 GCTATGTGCACAGTCCTCATGGG No data
912141599_912141603 -7 Left 912141599 1:106736758-106736780 CCAGGGTATAGCCTCCGCTATGT No data
Right 912141603 1:106736774-106736796 GCTATGTGCACAGTCCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912141603 Original CRISPR GCTATGTGCACAGTCCTCAT GGG Intergenic
No off target data available for this crispr