ID: 912143825

View in Genome Browser
Species Human (GRCh38)
Location 1:106766564-106766586
Sequence CTGTGAACTCAGATGTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912143824_912143825 8 Left 912143824 1:106766533-106766555 CCTCTCTGAAGAAGCATTTTAAT No data
Right 912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG No data
912143823_912143825 11 Left 912143823 1:106766530-106766552 CCTCCTCTCTGAAGAAGCATTTT No data
Right 912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG No data
912143822_912143825 14 Left 912143822 1:106766527-106766549 CCTCCTCCTCTCTGAAGAAGCAT No data
Right 912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912143825 Original CRISPR CTGTGAACTCAGATGTGACT AGG Intergenic
No off target data available for this crispr