ID: 912146735

View in Genome Browser
Species Human (GRCh38)
Location 1:106803374-106803396
Sequence AGGTAGAACTAGAATTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912146735 Original CRISPR AGGTAGAACTAGAATTGTTG GGG Intergenic
904591888 1:31619474-31619496 AGGCAGAACTAGGATGGGTGTGG + Intronic
904951227 1:34240619-34240641 AGGTAGAAGTTGAATGTTTGGGG - Intergenic
906794436 1:48685876-48685898 AGTCACAACTAAAATTGTTGTGG + Intronic
908557529 1:65271564-65271586 ATGTAGAAATAGAATTGATTAGG + Intronic
908699966 1:66888342-66888364 GGGTAGAAGTAGAATTGTTTAGG + Intronic
909754451 1:79206187-79206209 AGGTAGAAATAGAATTTATAAGG - Intergenic
909861629 1:80612710-80612732 GAGTAGAACTAGTTTTGTTGGGG + Intergenic
910061524 1:83098885-83098907 ACGTGTAACTAGAACTGTTGGGG + Intergenic
910997492 1:93123365-93123387 ACGTATAACAAGAATTGCTGAGG - Intronic
912146735 1:106803374-106803396 AGGTAGAACTAGAATTGTTGGGG + Intergenic
916387111 1:164287164-164287186 AGATAAAACTAGAATTAATGAGG + Intergenic
918101367 1:181378094-181378116 ACTTAGCACTAGACTTGTTGTGG + Intergenic
921327587 1:214002033-214002055 AGGCAGAACTAAAATTCTTTAGG + Intronic
922079746 1:222284244-222284266 ATTTAGAACTAGAATTGAGGAGG - Intergenic
922084023 1:222328191-222328213 ATATAGAACTAGATTTGTAGAGG - Intergenic
1064573954 10:16725453-16725475 AGTTTGAACTTGAATTGTAGAGG - Intronic
1069031684 10:63602968-63602990 AGTTAGAAATAAAATTTTTGTGG - Intronic
1069584663 10:69590302-69590324 GGGTAGGCCTAGTATTGTTGGGG + Intergenic
1071473764 10:86007239-86007261 AACTAGAACTAGATTTGTTGTGG + Intronic
1072155341 10:92718566-92718588 AGATAGTAACAGAATTGTTGTGG + Intergenic
1078962943 11:16300757-16300779 ATGTAGATCTAGAAGTGTTGAGG - Intronic
1079397963 11:20082348-20082370 TGGAAGAACTGGAATTGTAGAGG + Intronic
1079785042 11:24661355-24661377 AGGTAGAACAAAACTTGGTGAGG + Intronic
1080441794 11:32301246-32301268 ACCTAGGAGTAGAATTGTTGTGG - Intergenic
1080477091 11:32605789-32605811 AGCTAGAACTAAAATTACTGCGG - Exonic
1085029283 11:73259843-73259865 AAGAACAACTAGAATTGTTTGGG - Intergenic
1087879850 11:103403208-103403230 GGGTAGACCTAGAAATGTTGGGG + Intronic
1091932321 12:4405813-4405835 AGGTGGCAGCAGAATTGTTGTGG + Intergenic
1093297581 12:17410304-17410326 AGGCAGAAATAGAAGTGTTTAGG + Intergenic
1093537932 12:20244996-20245018 AGGAAGAACTAGAATAATTCTGG + Intergenic
1095672676 12:44878257-44878279 AGGTTCAACTAGAATTATTTTGG - Intronic
1099082724 12:78206428-78206450 AGGTAGGACTGGAATTTTTGAGG - Intronic
1099357054 12:81650592-81650614 AGGTAAAACTAGATTAGTTTAGG + Intronic
1101195094 12:102373489-102373511 AGATAGAACCAGATATGTTGTGG + Intergenic
1104356691 12:128093028-128093050 TGGTAGAAGAAGAATTGTTTTGG + Intergenic
1108130154 13:47290260-47290282 GGGTAGAAGTAGAAGTGTGGGGG + Intergenic
1108373606 13:49793559-49793581 TGGTAGAACAAGAAGTGTTGGGG - Intergenic
1110548126 13:76779732-76779754 AGGTAGAAATGCAATTGTAGTGG - Intergenic
1111428718 13:88124435-88124457 AGGTAAACCTACAATTGCTGGGG - Intergenic
1116761935 14:49025854-49025876 AGGTTTAACTAGAATTTTTATGG - Intergenic
1118110161 14:62709388-62709410 AGGCAGAACTAGAATTTGTGAGG + Intronic
1119518060 14:75264088-75264110 AGGTAAAACCAGAAGTGTTCAGG - Intronic
1119770100 14:77215199-77215221 AGGTAGAAATAGAAGTCTAGGGG - Intronic
1120730036 14:87992210-87992232 AGGTTGAACTCGGATTTTTGGGG - Intronic
1121947593 14:98137496-98137518 AGGAAGAGCAAGAAGTGTTGGGG + Intergenic
1122240225 14:100359861-100359883 AGGTAGAATTTGAAGTGTTTGGG + Intronic
1125679083 15:41519694-41519716 GGGTAGAATTTGAATTGGTGAGG - Intronic
1126471699 15:49019142-49019164 AGGTAGAACTTGATTTCATGTGG - Intronic
1130452270 15:84067804-84067826 AGGGAGAACTAGAGTGGATGTGG - Intergenic
1132334788 15:101039811-101039833 AGGCAGAACAAGCATTTTTGGGG - Intronic
1134204456 16:12225771-12225793 AGGAAGAACAAGACTTGTTTGGG - Intronic
1134798990 16:17067212-17067234 AGCAAGAACTAGATTTGTTTTGG + Intergenic
1138279745 16:55763764-55763786 AGGTAGAACCAGAACTGATGCGG + Intergenic
1138288757 16:55829885-55829907 AGGTAGAACCAGAACTGATGCGG - Intronic
1138927583 16:61611341-61611363 AGGTACAAATATAATTGTTGCGG + Intergenic
1148362395 17:47022929-47022951 ATCTAGAAATGGAATTGTTGGGG + Intronic
1156892798 18:42209149-42209171 AGGTAAAAATAGAACTTTTGAGG + Intergenic
1157930250 18:51813731-51813753 AGGTAGATGAAGAATTGTAGTGG - Intergenic
1158116751 18:54004766-54004788 AAGTAGAAGTAGAATTGGTGGGG - Intergenic
1164471009 19:28532527-28532549 ACCTAGAAGTAGAATTGTTGGGG - Intergenic
1166459475 19:42973535-42973557 TGGAAGAAGAAGAATTGTTGTGG - Intronic
1166476797 19:43133580-43133602 TGGAAGAAGAAGAATTGTTGTGG - Intronic
926412786 2:12621820-12621842 AGCTAGAAATAGAAATGTTCAGG - Intergenic
926892732 2:17651730-17651752 AGGAAGAGCTAGAAGTGATGGGG - Intronic
928051357 2:27999494-27999516 AGGTTGAAGTAGAATTGTAAGGG + Intronic
928162302 2:28939402-28939424 AGGTATAACCAGAGTAGTTGTGG + Intronic
929057411 2:37890409-37890431 ACGTAGGAGTAGAATTGCTGGGG - Intergenic
933512352 2:83257060-83257082 ATGGAGAAATAGAATCGTTGAGG + Intergenic
936478759 2:112865728-112865750 AGGAAGAAGCAAAATTGTTGAGG - Intergenic
936734486 2:115424985-115425007 AGAGAGAAGTAGAATCGTTGGGG + Intronic
936811148 2:116404036-116404058 ATATCTAACTAGAATTGTTGAGG + Intergenic
937202225 2:120211085-120211107 GGGTAGACCTAGAATTGTTGGGG - Intergenic
937619573 2:123970482-123970504 AAGTATAACTAGAACTGATGAGG - Intergenic
939510672 2:143100559-143100581 GGGTAGGCCTAGAATTGTTGGGG + Intronic
941109082 2:161397455-161397477 AGGTAGAAGTAGAAGGATTGAGG + Intronic
941556309 2:166986872-166986894 AGGAAGAAGTAGAATTGTCTAGG + Intronic
942499319 2:176572094-176572116 AGGTAGATTCAGAATTATTGGGG - Intergenic
942598060 2:177611129-177611151 AAATAGAAATAGAATTGTTAGGG + Intergenic
942769776 2:179502872-179502894 AGTTTGAACCAAAATTGTTGTGG - Intronic
943773046 2:191739729-191739751 AGATAGAACAAGAAGTGTTGAGG - Intergenic
943926820 2:193794815-193794837 AGATAAAAATAGAATTGTTTTGG + Intergenic
944304163 2:198159365-198159387 ATGTAAAACCAGAAATGTTGTGG + Intronic
944741342 2:202615795-202615817 AGGTAGACCTAGAATTGTCGGGG - Intergenic
945211988 2:207393075-207393097 GGGTTGAATTAGAAATGTTGGGG - Intergenic
945853354 2:215036642-215036664 AGGTAGAAATCGATTTGTTGAGG + Intronic
945900475 2:215532229-215532251 AGGTAAAACTAGAAATTTTTAGG + Intergenic
947066457 2:226231612-226231634 AGGCAGAACTAGAACGCTTGGGG - Intergenic
1169895550 20:10501742-10501764 TGGTGAAACAAGAATTGTTGTGG + Intronic
1173225129 20:41158082-41158104 AGGTAGAACCAGAAATGTGTCGG + Intronic
1174531967 20:51221510-51221532 AAGTAGAACATGAAGTGTTGAGG + Intergenic
1177369806 21:20187614-20187636 AGATAGAAGTAGAATTGCTCTGG + Intergenic
1177800380 21:25823173-25823195 TGGCAGAAGTAGAACTGTTGAGG - Intergenic
1178177506 21:30119873-30119895 AAGAAGAAATAGAATTGTTGAGG + Intergenic
1180177096 21:46096166-46096188 AGGTAGAACCAGTATGGCTGAGG - Intergenic
1182103580 22:27673729-27673751 AGGTGACACTAGAATTGTTTGGG - Intergenic
952813340 3:37424685-37424707 AGGTAGAATTAGAAATGGTTTGG - Intronic
953475651 3:43203688-43203710 AGGCAGAAAGAGAATTGTTGAGG - Intergenic
953537345 3:43786504-43786526 AGGAAGACGTAGAATTGATGAGG + Intergenic
958143001 3:89587589-89587611 AGGTAGACCTAGAATTGTCAGGG + Intergenic
960607130 3:119518033-119518055 AGCAAGAAATAGAATTTTTGTGG - Intronic
962525352 3:136233215-136233237 AGGTAAAGATAGAATTGTTGTGG - Intergenic
963207151 3:142648375-142648397 AGGTTTAACTAAAATTGTTGCGG + Intronic
963366878 3:144346416-144346438 AAGTAGAAATACAATTTTTGAGG - Intergenic
965589780 3:170351448-170351470 TGGTAGAATGAGAATTGTAGTGG - Intergenic
966011457 3:175083507-175083529 AGGTAAAACTAGATTTTTTTTGG - Intronic
966558744 3:181294248-181294270 AAGTAGAACTAGAATCGCAGTGG - Intergenic
970794936 4:19900106-19900128 AGGAATAATTAGAATTGTTATGG - Intergenic
972870528 4:43292343-43292365 ATGAAAAACTAGAATTGTTATGG - Intergenic
973249254 4:48044618-48044640 AAGTATAACTATCATTGTTGGGG - Intergenic
974166445 4:58210903-58210925 AGCTAGAACTAGAATTTATATGG + Intergenic
974924994 4:68286892-68286914 AGTAAGAACTAGAATCATTGTGG - Intergenic
978499134 4:109389796-109389818 AAGTAGAAGTAGATTTTTTGTGG - Intergenic
982443009 4:155458587-155458609 GGGTAGGCCTAGAATTGTCGGGG + Intergenic
982596311 4:157389214-157389236 AGGTGGAACTGGAAGTGTAGGGG - Intergenic
983290437 4:165797403-165797425 TGGTAGAACTGGAGCTGTTGAGG + Intergenic
986432680 5:7697123-7697145 AGGTAGAACTGGAATTGGGTGGG - Intronic
988592975 5:32565151-32565173 AGGCAGAACTAGCATGGGTGGGG + Intronic
989702277 5:44283903-44283925 ATTTAGGAGTAGAATTGTTGGGG - Intergenic
992138282 5:73769658-73769680 AGGTAGGAATGGAATTGTTGTGG + Intronic
992318541 5:75585671-75585693 AGGTAGAAGGTAAATTGTTGTGG + Intronic
992322352 5:75626148-75626170 AGGGAGAACAGGAAATGTTGAGG + Intronic
995948385 5:117679459-117679481 AGGAGGAACTAGAATTAATGTGG - Intergenic
998603275 5:143606657-143606679 AAGTAGAACTAGAAAAGGTGTGG - Intergenic
1005363250 6:25052744-25052766 AGGTAGATTTAAAATTTTTGTGG + Intergenic
1006574037 6:35030702-35030724 AGGTAAAACCAGAATTGATGGGG - Intronic
1007357645 6:41332914-41332936 AGGTATAAGCAGACTTGTTGGGG + Intergenic
1008016311 6:46524319-46524341 ATCTAGAACTAGAATGGTTTTGG - Intergenic
1010687759 6:78872056-78872078 ATGTAGAACTAGAATGACTGAGG + Intronic
1010897825 6:81387267-81387289 AGGCAGAACTAGAAATGTGAGGG + Intergenic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1014578126 6:123099717-123099739 AAGTAGCACTGGAATTGATGAGG - Intergenic
1014707947 6:124771199-124771221 AAGTAGAACAAAAAGTGTTGTGG + Intronic
1016696514 6:147002528-147002550 AGGTATAAATAGAATAGTAGTGG + Intergenic
1021854848 7:24844435-24844457 TGGAAGAAGAAGAATTGTTGTGG - Intronic
1026328293 7:69330142-69330164 AGGTAGACCTAGAATTGTTGGGG + Intergenic
1026808172 7:73440942-73440964 AACTAGAGCTAGATTTGTTGTGG + Exonic
1027985146 7:85277978-85278000 TGGTAGAAGAAGAATTGTTTTGG + Intergenic
1028131258 7:87176572-87176594 TGGTAGAAATAGAATTGGTAGGG + Intronic
1028729133 7:94125027-94125049 AGGCAGACCCAGAATTGTTCTGG - Intergenic
1030251552 7:107450943-107450965 ATGTTGAATTAGAGTTGTTGTGG - Intronic
1031495457 7:122442113-122442135 ATGTAGAACTAGAAATATTTGGG - Intronic
1032610303 7:133405138-133405160 AGGTAGAATTTAAAATGTTGAGG + Intronic
1032978708 7:137255983-137256005 AGGTAGTACTAGATTAGTTTAGG + Intronic
1042331808 8:67588352-67588374 GGGTAGGCCTAGAATTATTGGGG + Intronic
1042876809 8:73448033-73448055 AAGTCAAACTAGAATTGTTTTGG - Intronic
1044354299 8:91203046-91203068 AGGGAGAAGTAGGCTTGTTGGGG + Intronic
1046089621 8:109485566-109485588 GGATAAAACTATAATTGTTGAGG + Intronic
1049894504 9:100966-100988 AGGGAGAACAGGAATTTTTGGGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051865688 9:21678603-21678625 AGGCAAAATTATAATTGTTGAGG + Intergenic
1053735714 9:41100956-41100978 AGGGAGAACATGAATTTTTGGGG - Intergenic
1054692665 9:68330442-68330464 AGGGAGAACCTGAATTTTTGGGG + Intronic
1054953607 9:70882773-70882795 AGGTCTACCTTGAATTGTTGAGG + Intronic
1055601889 9:77928027-77928049 AAGTAGAACTAGAAATTTTAAGG + Intronic
1060495183 9:124113263-124113285 AGGTTGAACAGGAATTGTTCAGG - Intergenic
1062058433 9:134481545-134481567 AGGAATACCTAGAAGTGTTGGGG - Intergenic
1186186844 X:7029188-7029210 TGGAAGAAGAAGAATTGTTGTGG - Intergenic
1188790837 X:34406284-34406306 AGGTAGAACTACAATGCTTAGGG - Intergenic
1190383549 X:49862609-49862631 AGGTGGAACTAAGATTGATGTGG - Intergenic
1196009268 X:110869798-110869820 AGGTACTAATAGAATTGTTGGGG - Intergenic