ID: 912148913 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:106831940-106831962 |
Sequence | ATTTTTCAGCCTATTACATT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912148911_912148913 | 12 | Left | 912148911 | 1:106831905-106831927 | CCTGACAGTCAGGGCTTGGACAT | No data | ||
Right | 912148913 | 1:106831940-106831962 | ATTTTTCAGCCTATTACATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912148913 | Original CRISPR | ATTTTTCAGCCTATTACATT TGG | Intergenic | ||
No off target data available for this crispr |