ID: 912148913

View in Genome Browser
Species Human (GRCh38)
Location 1:106831940-106831962
Sequence ATTTTTCAGCCTATTACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912148911_912148913 12 Left 912148911 1:106831905-106831927 CCTGACAGTCAGGGCTTGGACAT No data
Right 912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912148913 Original CRISPR ATTTTTCAGCCTATTACATT TGG Intergenic
No off target data available for this crispr