ID: 912158117

View in Genome Browser
Species Human (GRCh38)
Location 1:106947359-106947381
Sequence TCTTATCTTAATAAGATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912158116_912158117 4 Left 912158116 1:106947332-106947354 CCACATGTCTGAAAGGTGGATAA No data
Right 912158117 1:106947359-106947381 TCTTATCTTAATAAGATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912158117 Original CRISPR TCTTATCTTAATAAGATAGA AGG Intergenic
No off target data available for this crispr