ID: 912162551

View in Genome Browser
Species Human (GRCh38)
Location 1:107003381-107003403
Sequence CAATTCCTCCCTATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912162551_912162552 -4 Left 912162551 1:107003381-107003403 CCTGGGGAAATAGGGAGGAATTG No data
Right 912162552 1:107003400-107003422 ATTGTCTATAAGCTGAGAGAAGG No data
912162551_912162553 16 Left 912162551 1:107003381-107003403 CCTGGGGAAATAGGGAGGAATTG No data
Right 912162553 1:107003420-107003442 AGGAACATAGAGTGAAGAGCTGG No data
912162551_912162555 22 Left 912162551 1:107003381-107003403 CCTGGGGAAATAGGGAGGAATTG No data
Right 912162555 1:107003426-107003448 ATAGAGTGAAGAGCTGGTTTGGG No data
912162551_912162554 21 Left 912162551 1:107003381-107003403 CCTGGGGAAATAGGGAGGAATTG No data
Right 912162554 1:107003425-107003447 CATAGAGTGAAGAGCTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912162551 Original CRISPR CAATTCCTCCCTATTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr