ID: 912164086

View in Genome Browser
Species Human (GRCh38)
Location 1:107021704-107021726
Sequence GTATCTATCGGTCATCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912164086_912164091 12 Left 912164086 1:107021704-107021726 CCTCTAGGATGACCGATAGATAC No data
Right 912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912164086 Original CRISPR GTATCTATCGGTCATCCTAG AGG (reversed) Intergenic
No off target data available for this crispr