ID: 912164088

View in Genome Browser
Species Human (GRCh38)
Location 1:107021726-107021748
Sequence AGTAGGGGGTTTGGGTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912164088_912164091 -10 Left 912164088 1:107021726-107021748 CCATACAACCCAAACCCCCTACT No data
Right 912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG No data
912164088_912164096 12 Left 912164088 1:107021726-107021748 CCATACAACCCAAACCCCCTACT No data
Right 912164096 1:107021761-107021783 GTTGCTATTTATGCTATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912164088 Original CRISPR AGTAGGGGGTTTGGGTTGTA TGG (reversed) Intergenic
No off target data available for this crispr