ID: 912164091

View in Genome Browser
Species Human (GRCh38)
Location 1:107021739-107021761
Sequence ACCCCCTACTCTAAATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912164088_912164091 -10 Left 912164088 1:107021726-107021748 CCATACAACCCAAACCCCCTACT No data
Right 912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG No data
912164086_912164091 12 Left 912164086 1:107021704-107021726 CCTCTAGGATGACCGATAGATAC No data
Right 912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG No data
912164084_912164091 30 Left 912164084 1:107021686-107021708 CCACAAGATTGTACTCAACCTCT No data
Right 912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG No data
912164087_912164091 0 Left 912164087 1:107021716-107021738 CCGATAGATACCATACAACCCAA No data
Right 912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912164091 Original CRISPR ACCCCCTACTCTAAATCACA TGG Intergenic
No off target data available for this crispr