ID: 912167425

View in Genome Browser
Species Human (GRCh38)
Location 1:107057267-107057289
Sequence AGAGCTCGGCGGAGGCCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912167425_912167439 27 Left 912167425 1:107057267-107057289 CCTGCCGGCCTCCGCCGAGCTCT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 912167439 1:107057317-107057339 TGGAATGGCGCCTGGGCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 144
912167425_912167435 12 Left 912167425 1:107057267-107057289 CCTGCCGGCCTCCGCCGAGCTCT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 912167435 1:107057302-107057324 TCAGCGACCAGATGCTGGAATGG 0: 1
1: 0
2: 0
3: 25
4: 229
912167425_912167437 19 Left 912167425 1:107057267-107057289 CCTGCCGGCCTCCGCCGAGCTCT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 912167437 1:107057309-107057331 CCAGATGCTGGAATGGCGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 186
912167425_912167432 7 Left 912167425 1:107057267-107057289 CCTGCCGGCCTCCGCCGAGCTCT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 912167432 1:107057297-107057319 CCCCATCAGCGACCAGATGCTGG 0: 1
1: 0
2: 1
3: 12
4: 127
912167425_912167438 20 Left 912167425 1:107057267-107057289 CCTGCCGGCCTCCGCCGAGCTCT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 912167438 1:107057310-107057332 CAGATGCTGGAATGGCGCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912167425 Original CRISPR AGAGCTCGGCGGAGGCCGGC AGG (reversed) Exonic
900155285 1:1201339-1201361 GGAGCCCGGGGGAGGCGGGCGGG - Intergenic
900645260 1:3706120-3706142 AGAGCCAGGCGGAGGCGGGCCGG - Intronic
900829980 1:4959051-4959073 AGAGGCCGGAGGAGGCCGGAAGG - Intergenic
905239101 1:36571087-36571109 ACAGCTGGGCTGAGGCAGGCAGG - Intergenic
912167425 1:107057267-107057289 AGAGCTCGGCGGAGGCCGGCAGG - Exonic
914919784 1:151839059-151839081 AGTGCTCGGCGGAGCGGGGCTGG + Exonic
915457999 1:156053475-156053497 AGAGGAGGGCGGGGGCCGGCTGG - Intronic
919862318 1:201748461-201748483 AGAGCTTGGTGGAGGCTGGTAGG - Intronic
920528143 1:206683929-206683951 AGAGGTGGGAGGAGGTCGGCAGG + Intronic
922112647 1:222576868-222576890 AGAGCTCAGAGGAGCCTGGCTGG - Intronic
1063908540 10:10805712-10805734 AGAGCTCAGAGGAGCCCGGCTGG + Intergenic
1064816822 10:19274812-19274834 AGAGCTGGGGGGAGGCAGGAAGG + Intronic
1071565300 10:86668529-86668551 AGAGCTCCACGCAGCCCGGCTGG + Exonic
1071570582 10:86694555-86694577 AGACCTGGGCAGAGGCTGGCTGG - Intronic
1073144699 10:101272796-101272818 AGAGGTTGGTGGAGGCCGGTGGG + Intergenic
1077074694 11:695044-695066 AAGGCTCGGCGGAGTCCGGATGG - Exonic
1077364377 11:2155616-2155638 GGAGCGCGTGGGAGGCCGGCGGG + Intronic
1077479685 11:2807757-2807779 AGAGGTCGGAAGAGGCCGGTAGG - Intronic
1077481280 11:2815795-2815817 GGAGCTCTGGGGAGGCCAGCAGG - Intronic
1078083051 11:8217830-8217852 AGAGCTGGGCCGAGGCAGGTGGG - Intergenic
1080743390 11:35085970-35085992 AGAGCTAGAAGGAGGCTGGCAGG + Intergenic
1081705481 11:45180414-45180436 ACAGCGCCGCGGAGGCCGGGCGG - Intronic
1084086416 11:66857229-66857251 AGGAGTCGGCGGGGGCCGGCCGG + Intronic
1084370080 11:68735443-68735465 AGAGTCAGGAGGAGGCCGGCAGG + Intronic
1084428982 11:69100994-69101016 AGACCTCAGAGGAGGCCTGCTGG + Intergenic
1084517475 11:69644553-69644575 AGGGCTCAGCTGAGCCCGGCTGG - Intronic
1088094123 11:106077933-106077955 AGATCTTGGGGGAGGCGGGCCGG + Intronic
1088607064 11:111541943-111541965 AGAGCTGGAAGGAGGCCCGCGGG - Intronic
1089565442 11:119368848-119368870 AGGGCTGGGCAGAGGCCAGCGGG + Intronic
1092123503 12:6060421-6060443 AGAGCTGGAGGGAGGCCAGCTGG - Intronic
1095465422 12:42483708-42483730 GGAGCTCGGCGGGGACCGGCCGG - Intronic
1095958478 12:47819579-47819601 AGAGCCCCGCGGAGCCGGGCGGG + Intronic
1096559543 12:52425641-52425663 AGAGCTAGGAGGAGGCTGGAGGG + Intronic
1097929641 12:65169869-65169891 AGAGGTCGCCCGAGACCGGCCGG - Exonic
1098026979 12:66214225-66214247 AGAGCTAGCTGGAGGCAGGCTGG + Intronic
1098161052 12:67648675-67648697 GGAGGGCGGCGGAGGGCGGCGGG + Intronic
1098288573 12:68933377-68933399 TGAGCTGGGCGGAGGGCTGCGGG + Intronic
1104892880 12:132148765-132148787 GCAGCTGGGCGGGGGCCGGCAGG - Exonic
1104989597 12:132618432-132618454 GGGGCGCCGCGGAGGCCGGCGGG + Intergenic
1110436375 13:75481783-75481805 AGGGCACCGCGGAGGCCGGCCGG + Exonic
1113605187 13:111599942-111599964 AGGGCTCGGGGGTGGCAGGCTGG + Intronic
1113768366 13:112894391-112894413 GGAGCTCGGCGGACGCGGGAGGG + Intronic
1113905912 13:113819125-113819147 TGAGCTCGGCCCAGGCGGGCAGG + Intergenic
1114065145 14:19053893-19053915 AGAGCATGGCAGAGGCTGGCAGG + Intergenic
1114097118 14:19346109-19346131 AGAGCATGGCAGAGGCTGGCAGG - Intergenic
1119655296 14:76413153-76413175 AGAGCTGGGCGCAGGCAGTCAGG + Intronic
1121796596 14:96741301-96741323 AGAGACAGGCGGAGGCAGGCAGG - Intergenic
1122858625 14:104572165-104572187 AGAGCCCGCAGGAGGCCAGCCGG - Intronic
1122940361 14:104978417-104978439 AGGGCTGGGCGGAGCCGGGCGGG - Intergenic
1123983456 15:25623818-25623840 AGAGCTGGGTGGAGGCCAGGGGG - Intergenic
1124125505 15:26935494-26935516 AGAGCTGTGGGGAGGCCGGCTGG - Intronic
1128567411 15:68710575-68710597 AAAGCTCGACTGAGGCCTGCTGG - Intronic
1128994963 15:72289165-72289187 AGAGCGTGTCGGAGCCCGGCTGG + Exonic
1130107068 15:80936838-80936860 CGAGTTCGGCGGGGGCCGTCTGG - Exonic
1130531009 15:84748227-84748249 GGAGCCGGGCGGGGGCCGGCCGG + Intergenic
1130908499 15:88255863-88255885 AGAGCGCGGGGGAGGCAGGCTGG + Intronic
1132688332 16:1171468-1171490 GGAGCCCGGAGGAGGCCCGCGGG + Intronic
1133221347 16:4320398-4320420 AGAGGTCGTCGGAGGCCGGTGGG + Intronic
1136341760 16:29648585-29648607 AGAGCTGGGCGGGAGCCAGCTGG - Intergenic
1136666765 16:31819477-31819499 GGAGCCCGGCGGCGGCGGGCCGG + Intergenic
1138070014 16:53983642-53983664 AGATCTCTGCAGAAGCCGGCAGG + Intronic
1138657354 16:58499137-58499159 CGAGCTCGCCCGAGGCCTGCAGG - Intronic
1139957193 16:70698675-70698697 AGAGCTCTGTGGAGGTCAGCAGG + Exonic
1141650566 16:85390714-85390736 AGAGCTGGGCGGTGGCGGGGAGG - Intergenic
1142406784 16:89894437-89894459 GGAGCTCTGCGGAGGCTGTCCGG - Intronic
1142854437 17:2721998-2722020 AGAGCTGGGGGGAGGCCAGGCGG + Intergenic
1143582864 17:7836540-7836562 AGATCTCGGTGGGGGCCGGCAGG - Intergenic
1143746994 17:9002407-9002429 AGAGCTTGGAGGAGGCGCGCCGG + Intergenic
1144664918 17:17095842-17095864 ACAGCTAGGAGGAGGCAGGCTGG - Intronic
1147155053 17:38540415-38540437 TGAGCTCTACGGTGGCCGGCGGG - Intronic
1148765453 17:50036102-50036124 AGTGCTCGGGGGAGACAGGCAGG - Intergenic
1152252594 17:79219698-79219720 AGAGCTCCGGGGAGGTCGGCTGG + Intronic
1152335552 17:79698598-79698620 AGAGCTTGGCTGAGGCCCACAGG - Intergenic
1158982692 18:62779863-62779885 AAAGCTTGGCTGAGGCAGGCTGG + Intronic
1160418444 18:78727914-78727936 AGAGCTCCGTGGAGACAGGCAGG + Intergenic
1160576419 18:79856839-79856861 TGAGCCCTGGGGAGGCCGGCAGG + Intergenic
1160715111 19:572912-572934 AGCGCCCGGGGGAGCCCGGCAGG - Intronic
1160810186 19:1009945-1009967 AGAGCCGGGCTGAGGCCGGCCGG + Exonic
1160861135 19:1237647-1237669 AGGGCGCGGAGGAGTCCGGCGGG - Intronic
1160941479 19:1622194-1622216 AGAGCTCGGCTGAGGGGTGCAGG + Exonic
1161998739 19:7730412-7730434 AGGGCTTGGCTGAAGCCGGCAGG - Exonic
1163673792 19:18645181-18645203 CGAGCTGGGAGGAGGCCAGCTGG - Intronic
1165309897 19:35023517-35023539 GGAGCTCCACGGAGGCCCGCAGG - Exonic
1165378551 19:35461204-35461226 AGAGCTCGGGGGATGCGAGCAGG + Intergenic
1165713471 19:38028469-38028491 AGAGCTCGGGGAAGGCCTCCCGG - Intronic
1166539960 19:43598792-43598814 AGAGGTCAGGGGAGGCCAGCAGG - Intronic
1167609913 19:50502039-50502061 AGGGCTCTGCAGAGGCTGGCGGG - Intergenic
1168099170 19:54131940-54131962 AGATCTCAGCGCAGGCCGACCGG + Intergenic
1168239432 19:55081825-55081847 AGAAGTCGGCGGAGGCGGCCAGG + Exonic
927502950 2:23594343-23594365 AGAGCCCGGAGGAGCCGGGCAGG - Intronic
928323186 2:30300150-30300172 AGAGCTGGGCTGGGGCCGGGAGG - Intronic
928607920 2:32961249-32961271 AGAGCTCGGCAGAGACCCGGAGG - Intronic
929780166 2:44952279-44952301 AGAGCGCCGCGAAGGCCGGAGGG - Intergenic
933666956 2:84971527-84971549 CGGGCGCGGCGGAGGGCGGCCGG + Intronic
938482398 2:131672896-131672918 AGAGCATGGCAGAGGCTGGCAGG + Intergenic
943060500 2:183037952-183037974 AGGCCGCGGCGGAGGCGGGCGGG - Intronic
946929153 2:224655482-224655504 CGAGCACCGCGCAGGCCGGCCGG - Intergenic
947791232 2:232870554-232870576 AGAGCTCTTGTGAGGCCGGCTGG + Intronic
948399178 2:237670696-237670718 AGAGCTGGGCCCAGGCAGGCAGG - Intronic
1168753185 20:297930-297952 AGGGCGCTGCGGAGGCGGGCAGG + Exonic
1169046599 20:2538250-2538272 AGAGCTGGGCAGAGGCTGGCAGG + Intronic
1169141922 20:3231298-3231320 AGAGGCCGGCGGGGGCCGGCAGG - Intronic
1169145402 20:3248940-3248962 ACAGCTCGGCCGCGGCAGGCTGG + Intergenic
1170103411 20:12727201-12727223 AGAGCTGGGTGGAGGGAGGCAGG - Intergenic
1173891295 20:46513266-46513288 AGAGCTCGCCCGTGGCCTGCAGG + Intronic
1175574961 20:60053971-60053993 AGAGCTCAGGGAAGGCCTGCAGG + Intergenic
1175986015 20:62764512-62764534 AGAGCCAGGAGGAGGCCGGATGG + Intergenic
1176159816 20:63642347-63642369 AGAGCAGGGAGGAGTCCGGCCGG - Intronic
1178054543 21:28783940-28783962 AGAGCTCAGCGCCGGCAGGCTGG - Intergenic
1179732755 21:43376595-43376617 AGAGCTCAGAGGAGGCAGGCGGG - Intergenic
1180483635 22:15776513-15776535 AGAGCATGGCAGAGGCTGGCAGG + Intergenic
1182123242 22:27800087-27800109 AGCCCTCGGCGAAGGGCGGCTGG + Exonic
1183577514 22:38701173-38701195 GCACCTCGGCGGCGGCCGGCAGG + Intronic
1183942083 22:41301732-41301754 CGGGCTCGGCGCAGGCCCGCGGG + Exonic
1184445302 22:44543756-44543778 GGTGCTCGGCGGGGGCGGGCGGG + Intergenic
1184520801 22:44992841-44992863 AGAGCTGGGATGAGGCCGACAGG - Intronic
1184763728 22:46560942-46560964 GGAGCTGGGTGGAGGCTGGCTGG + Intergenic
1185004823 22:48269802-48269824 AGAGCGCTGAGGAGGCAGGCTGG - Intergenic
1185055598 22:48576945-48576967 AGCGCTCCACGGTGGCCGGCCGG + Intronic
954223979 3:49171228-49171250 GGAGCTCCGCGGAGGTGGGCAGG + Intergenic
954277853 3:49554303-49554325 GGAGCCGGGCGGGGGCCGGCGGG - Intergenic
960617541 3:119609542-119609564 ACAGCTCTTCGGAGGCCAGCTGG + Exonic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
962738926 3:138348861-138348883 AGAGCGCGGCCGAGCCCGGAGGG - Intronic
968730447 4:2267081-2267103 GGAGCTCAGGGGAGGCAGGCAGG - Intergenic
969258849 4:6021299-6021321 AGAGCTGGGGGGAGGCTGGGAGG + Intergenic
969517265 4:7654664-7654686 AGAGCAGGGCTGAGGCAGGCCGG - Intronic
969525409 4:7701664-7701686 AGACCTGGGTGGGGGCCGGCAGG - Intronic
970192258 4:13528090-13528112 TGAGCTCTCCGGAGGCTGGCGGG - Intergenic
975661128 4:76689730-76689752 AGAGGGAGGCGGGGGCCGGCCGG + Intronic
980230241 4:130038718-130038740 CGAGCTCGGCGCCGGCGGGCTGG + Intergenic
981713575 4:147732062-147732084 AGAGCTCGGCGGGGGCTGCCGGG + Exonic
982010335 4:151099779-151099801 AGATCGCGGCGTAGGCCGGATGG + Intronic
983784610 4:171715771-171715793 ACAGCTCAGAGGAGGCCTGCAGG - Intergenic
985190407 4:187366611-187366633 AGAGCTCAGAGGAGGCTGGCTGG - Intergenic
985549174 5:524509-524531 AGTGCGCGGCGGGGGCGGGCAGG - Intergenic
985622806 5:964411-964433 AGAGCCCTGGGGAGCCCGGCTGG + Intergenic
985637929 5:1049003-1049025 AGAGCACGGGAGCGGCCGGCTGG - Intergenic
985646213 5:1085879-1085901 AGAGCTCGGCCCACCCCGGCTGG + Intronic
985995741 5:3596035-3596057 GGAGGGAGGCGGAGGCCGGCCGG - Exonic
986576090 5:9214299-9214321 AGAGCTCGGGCCAGGCCTGCTGG + Intronic
992003831 5:72459630-72459652 AGAGCTTGGCTGAGGCCGGCAGG - Intronic
992105638 5:73447591-73447613 AGAGCGCGGCGGCGGCTGCCGGG + Exonic
997990723 5:138542832-138542854 AGAGCTTGGAGGCGGCCCGCGGG - Exonic
998087920 5:139341923-139341945 GGAGATCCGCGGAGGCCGACAGG + Intronic
998406402 5:141876910-141876932 AGAGCTCCGGGGAGGCGGGATGG + Intronic
1000029594 5:157390467-157390489 AGAGGTCGGGGGAGGAGGGCAGG - Intronic
1002257736 5:177971170-177971192 GGAGCTCGGCGGAGACGGGAAGG + Intergenic
1002405081 5:179024068-179024090 AGGGCCTGGCGGAGGCCGGGAGG + Intronic
1002417046 5:179126141-179126163 AGAGCTCGACGGGGGTCGGTGGG + Intronic
1003139169 6:3456781-3456803 AGAGGCGGGCAGAGGCCGGCCGG + Intronic
1004690233 6:17987305-17987327 AGAGCGCGGCCGGGGCCGGGGGG - Intronic
1005825393 6:29628792-29628814 AGAGCCCAGCAGAGGGCGGCAGG - Intronic
1011187111 6:84689504-84689526 AGAGCCCAGCTGAGGCAGGCAGG - Intronic
1018017841 6:159727700-159727722 AGAGGTAGGCGCGGGCCGGCTGG + Intronic
1020141797 7:5615746-5615768 AGTGCTTGGCCGAGGACGGCAGG - Intergenic
1021649694 7:22821491-22821513 CGCGCGGGGCGGAGGCCGGCTGG + Intronic
1023790386 7:43749365-43749387 AGAGCTCAGAGGAGACCAGCAGG + Intergenic
1035026769 7:155831388-155831410 GGAGCTGGGTAGAGGCCGGCGGG + Intergenic
1037313186 8:17577371-17577393 AGAGCTGGCAGGAGGGCGGCGGG - Intronic
1037803919 8:22049153-22049175 GGAGCCCGGCGGAGCCCGGGCGG + Intronic
1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG + Intergenic
1039554783 8:38468059-38468081 AGAGCCCGGGGGCGGCGGGCCGG - Intronic
1039813683 8:41072992-41073014 AGAGGTCGGGGGAGGCCTCCAGG + Intergenic
1045367701 8:101492520-101492542 CGAGCTCGGAGGCGGCCGGGCGG - Exonic
1048977559 8:139681481-139681503 AGAGCAGGGCGGAGCCCGGTGGG + Intronic
1049470099 8:142771439-142771461 AGGGCTGGGCGGAAGCTGGCAGG + Intronic
1049544290 8:143222161-143222183 AGAGCACGGCGGAGAGCTGCAGG - Intergenic
1049646547 8:143738296-143738318 TGAGCTGGCCTGAGGCCGGCTGG - Intergenic
1053430111 9:38036526-38036548 AGAGCTTGGCTGAGGCTGGGTGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061719179 9:132541236-132541258 TGAGCTCTGAGGAGGGCGGCTGG - Intronic
1062421028 9:136482877-136482899 GGAGGAAGGCGGAGGCCGGCCGG - Intronic
1203788381 EBV:140770-140792 GGAGCTCGGGGGCGGCCGGGTGG + Intergenic
1190681705 X:52831545-52831567 GCAGCTGGGCGGAGGCCTGCAGG + Intergenic
1191988762 X:67009910-67009932 AGAGCACTGGGGAGGCTGGCTGG - Intergenic
1199698936 X:150362746-150362768 AGAGCCCGCCGGAGGGCCGCAGG - Intronic