ID: 912167750

View in Genome Browser
Species Human (GRCh38)
Location 1:107060328-107060350
Sequence CAGACAGATTGGACAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912167750_912167756 18 Left 912167750 1:107060328-107060350 CCAGGCACTGTCCAATCTGTCTG 0: 1
1: 0
2: 1
3: 17
4: 222
Right 912167756 1:107060369-107060391 GCTTGGTGCCATTGGACCACAGG 0: 1
1: 0
2: 0
3: 3
4: 86
912167750_912167754 1 Left 912167750 1:107060328-107060350 CCAGGCACTGTCCAATCTGTCTG 0: 1
1: 0
2: 1
3: 17
4: 222
Right 912167754 1:107060352-107060374 ATGGACTGGTACTGACTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 108
912167750_912167757 22 Left 912167750 1:107060328-107060350 CCAGGCACTGTCCAATCTGTCTG 0: 1
1: 0
2: 1
3: 17
4: 222
Right 912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG 0: 1
1: 0
2: 5
3: 102
4: 2799
912167750_912167755 10 Left 912167750 1:107060328-107060350 CCAGGCACTGTCCAATCTGTCTG 0: 1
1: 0
2: 1
3: 17
4: 222
Right 912167755 1:107060361-107060383 TACTGACTGCTTGGTGCCATTGG 0: 1
1: 0
2: 2
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912167750 Original CRISPR CAGACAGATTGGACAGTGCC TGG (reversed) Intergenic
901183491 1:7357429-7357451 CAGCCAGGTGGGGCAGTGCCAGG - Intronic
901225020 1:7608335-7608357 GAGACAAATTGGACAGAGCCAGG + Intronic
901530055 1:9847047-9847069 TAGACAGGTTAGACAGCGCCAGG + Intergenic
902108228 1:14055937-14055959 CAGAAAGACTGGACAGTGAAGGG - Intergenic
906943201 1:50273711-50273733 AAGACAGAGTTGACAGGGCCAGG + Intergenic
908523953 1:64969659-64969681 GAGATAGAATGGACAGTGCTTGG + Intergenic
911956381 1:104241025-104241047 CAAACAAATTGGAGAGTGGCAGG + Intergenic
912167750 1:107060328-107060350 CAGACAGATTGGACAGTGCCTGG - Intergenic
916006551 1:160666274-160666296 GAGACACATTGGGCAGAGCCCGG + Intergenic
916161949 1:161925764-161925786 TAGATACAATGGACAGTGCCTGG - Intronic
917163619 1:172086301-172086323 CAGTCTGATTGGACGGAGCCTGG + Intronic
917654503 1:177112766-177112788 CACACAGCTTAGACAGTCCCTGG + Intronic
918386302 1:184011446-184011468 CAGACAGATTGGAAGGTAACTGG - Intronic
919460263 1:197868924-197868946 CAGACAGAATTGTAAGTGCCCGG + Intergenic
921075875 1:211699622-211699644 CAAAGAGTTTGCACAGTGCCTGG - Intergenic
923685586 1:236151192-236151214 CAGACTGTTTAGACAGTACCTGG + Intronic
1066220392 10:33332607-33332629 TAGAGAGATTGAACAGAGCCAGG - Intronic
1066745287 10:38601330-38601352 CAGACAGAATCTACACTGCCTGG + Intergenic
1067074597 10:43168994-43169016 CAGACAGAATGGAGGGAGCCTGG + Intronic
1067233380 10:44427151-44427173 CAGCCAGGTAGGACAGGGCCAGG - Intergenic
1067451625 10:46385270-46385292 CTGGCAGAGTGGACAGGGCCAGG + Intronic
1067585614 10:47474486-47474508 CTGGCAGAGTGGACAGGGCCAGG - Intronic
1067748868 10:48957051-48957073 GAGGCAGAATGGACGGTGCCTGG + Intronic
1067848229 10:49739410-49739432 CAGAAGCATTGAACAGTGCCTGG + Intronic
1069901057 10:71706931-71706953 CAGACACATTGTACACGGCCGGG - Intronic
1070596766 10:77838112-77838134 TGGATAGACTGGACAGTGCCAGG - Intronic
1070754240 10:78981805-78981827 AAGAGAGAGTGGAGAGTGCCAGG + Intergenic
1071133266 10:82420949-82420971 GGGACAGATTGGAGATTGCCAGG + Intronic
1071434059 10:85630349-85630371 AAGACAGTGTGGAAAGTGCCTGG + Intronic
1072608878 10:97003810-97003832 CAGATAGCTCGGACAGTCCCAGG + Intronic
1074259367 10:111836286-111836308 CAGACAGAATGGAAAGAGCTGGG + Intergenic
1074772672 10:116743442-116743464 CAGGCAGGTAGCACAGTGCCAGG - Intergenic
1075072630 10:119328797-119328819 CAGACAGTTTAGCCAGGGCCGGG - Intronic
1075910130 10:126117414-126117436 CAGACTGCTTGGACGGTCCCAGG + Intronic
1076773808 10:132681997-132682019 GAGACAGAAAGTACAGTGCCTGG + Intronic
1077486746 11:2842248-2842270 CACACAGCCTGGACACTGCCCGG + Intronic
1078235258 11:9478497-9478519 CAGGCTGATGGGACAGTGGCAGG + Exonic
1079148814 11:17879066-17879088 CAGATGGATTGGACAAGGCCTGG + Intronic
1079398123 11:20083652-20083674 CAGAGAGATGAGACAGTGCATGG + Intronic
1080737943 11:35035732-35035754 CTGACAATTTGCACAGTGCCTGG + Intergenic
1082792313 11:57354903-57354925 CACACAGATAGTGCAGTGCCAGG + Intronic
1084068446 11:66718850-66718872 CAAACAGGTTGGACAGTGTTGGG + Intronic
1084866951 11:72066528-72066550 CACACAGCTTGGAAAATGCCTGG - Intronic
1085129271 11:74023793-74023815 CAGAGAAATAGGACAGTGGCTGG - Intronic
1086883587 11:92177657-92177679 CAGGCATAGTGGACACTGCCTGG - Intergenic
1088891147 11:114045328-114045350 CAGACAGATTGGAGAGAGCATGG - Intergenic
1088973739 11:114796079-114796101 CAAACAGATTGGACAGAACAAGG - Intergenic
1089040800 11:115447640-115447662 CACACAGATTCCCCAGTGCCTGG + Intronic
1089947709 11:122494830-122494852 CAGTCAGATTTGACTATGCCAGG - Intergenic
1090090898 11:123696839-123696861 GAGACAGATTGGAAACTGTCTGG - Intergenic
1090764961 11:129868596-129868618 CAGACACATTCGCCACTGCCTGG + Intronic
1091468065 12:702785-702807 CACACAGATGGGATAGTGGCAGG + Intergenic
1092234201 12:6795916-6795938 CAGACAGGATGGAGAGTGGCTGG + Intronic
1092312021 12:7367958-7367980 GAGATGGATTGGAAAGTGCCAGG - Intronic
1094388252 12:29918935-29918957 CAGACACTTTACACAGTGCCTGG - Intergenic
1095315328 12:40753817-40753839 CACATAGATTTGACAGTGTCTGG + Intronic
1096078704 12:48819851-48819873 CAGACAGCAGGGAGAGTGCCTGG + Intronic
1097446797 12:59681307-59681329 AAGACAGACAGGACAGTGCATGG - Intronic
1098880072 12:75907996-75908018 CAAGCAGATAGCACAGTGCCTGG + Intergenic
1099295749 12:80825961-80825983 GAAACACATTTGACAGTGCCAGG - Intronic
1100270021 12:93015833-93015855 AAGACAGATTGAACTGAGCCAGG - Intergenic
1101665632 12:106810841-106810863 CAAACACATAGGGCAGTGCCTGG - Intronic
1104653513 12:130556196-130556218 CAGACAGAGTGCACGTTGCCAGG - Intronic
1105509261 13:21037786-21037808 CAGGCAGAGTGGGCAGGGCCAGG + Intronic
1105606999 13:21934233-21934255 CAGACAGAATGAACAGAGCAAGG - Intergenic
1105610134 13:21961406-21961428 AAGACAAATGGGACAGAGCCTGG + Intergenic
1105643538 13:22291332-22291354 AAAACAGATTGGTCATTGCCGGG + Intergenic
1106654453 13:31727324-31727346 AAGACAGATTGGGCAGTGTATGG - Intergenic
1109720251 13:66267074-66267096 CAGAGTCATTGGACAGTGCCTGG - Intergenic
1111770576 13:92590926-92590948 CACACAGAAAGGACAGGGCCAGG - Intronic
1112487898 13:99836194-99836216 CAGACAGTGTGGACTCTGCCAGG + Intronic
1115087614 14:29536007-29536029 CAGCCAGATTTGACAGGGCGTGG - Intergenic
1116194627 14:41707308-41707330 AAGACAGATTTGACAGTAGCAGG - Intronic
1119287174 14:73464866-73464888 CAGACAGAAGGGATTGTGCCTGG + Intergenic
1120000354 14:79295956-79295978 CTGACACCCTGGACAGTGCCTGG - Intronic
1121008999 14:90508986-90509008 CAGGGTGATCGGACAGTGCCCGG - Intergenic
1121954023 14:98197836-98197858 GAGACAGAATGGACAGAGCAAGG + Intergenic
1122820585 14:104342885-104342907 CAGACTGGGTGGACAGCGCCAGG - Intergenic
1122969700 14:105147579-105147601 AAGCCAGCCTGGACAGTGCCTGG - Intronic
1123075446 14:105665426-105665448 CGGACAGCATGGACAGTGTCGGG + Intergenic
1125083411 15:35701907-35701929 CAGACAGATAGCACAGTGGGAGG - Intergenic
1131303361 15:91219271-91219293 CATCAAGATTGGACAGAGCCTGG + Intronic
1133065510 16:3203919-3203941 CAGACAGACGGGACAGAGGCTGG - Intergenic
1135547111 16:23373838-23373860 CAGACAGACAGGACAGTACAGGG + Intronic
1136737780 16:32478319-32478341 CAGACAGAATCTACACTGCCTGG - Intergenic
1139493314 16:67298959-67298981 CACACAGAATGGCCAGAGCCAGG - Intronic
1139791635 16:69441927-69441949 CAGACAGATTATCCAGGGCCAGG - Intronic
1140261835 16:73387089-73387111 GAGAGAGAATGGACTGTGCCAGG - Intergenic
1140541248 16:75758409-75758431 CAGGCTGAGTGGACAGTGCTTGG + Intronic
1141600869 16:85125522-85125544 CAGACAGAAGGGCCAGGGCCGGG + Intergenic
1141858977 16:86703841-86703863 CAGACAGATGGAACAGAGGCAGG - Intergenic
1142030632 16:87836717-87836739 CAGCCAGGCTGGACAGTCCCCGG - Intronic
1203015293 16_KI270728v1_random:351258-351280 CAGACAGAATCTACACTGCCTGG + Intergenic
1203033628 16_KI270728v1_random:624416-624438 CAGACAGAATCTACACTGCCTGG + Intergenic
1142807870 17:2380847-2380869 CAGACAGGCTGTGCAGTGCCCGG - Exonic
1143396772 17:6605504-6605526 AAGACAGGTTGAACAGAGCCTGG - Intronic
1144444061 17:15310015-15310037 GTGACAGATTGAAGAGTGCCTGG - Intronic
1145248446 17:21284698-21284720 GAGACAGACTGGGCAGCGCCGGG - Exonic
1146368831 17:32251367-32251389 CAGACAGTCTGGAGATTGCCAGG + Intronic
1146532582 17:33622118-33622140 CAGACACCTTGCACAGTGCCAGG - Intronic
1150144299 17:62754795-62754817 CAGATAGCTTGGAAAGTTCCTGG + Intronic
1150827171 17:68487201-68487223 TACACACATTGCACAGTGCCTGG + Intergenic
1151564049 17:74887404-74887426 CAGGGACATTGGACAGTGTCTGG - Intronic
1152657305 17:81525970-81525992 CACACAGCTGGGTCAGTGCCAGG + Intergenic
1152766762 17:82145672-82145694 CCCACAGAGTGGGCAGTGCCTGG - Intronic
1152939269 17:83158729-83158751 CAGAGAGATTGGGCCGTGCACGG - Intergenic
1153509321 18:5834777-5834799 CAGACAGATTGGTGAGTTCATGG - Intergenic
1156436737 18:37138900-37138922 CAGAAAGATTTGACAGTACATGG + Intronic
1157824215 18:50797887-50797909 CAGACAGAGTGGCAAGTGCCAGG - Intronic
1158082320 18:53607205-53607227 CAGAAAGATGGGACAGAGTCAGG - Intergenic
1158285900 18:55882543-55882565 CAGTCAGATAGGGCAGAGCCAGG + Intergenic
1159595491 18:70378847-70378869 CTGACAGATTCCACAATGCCAGG + Intergenic
1160126261 18:76175157-76175179 AAGACAGATCAGACAGTGCCTGG - Intergenic
1160858119 19:1226476-1226498 CAGTCACAATGGACAGCGCCGGG + Exonic
1164961019 19:32430109-32430131 CAGACAGAAGCCACAGTGCCTGG - Intronic
1165806082 19:38581519-38581541 CAGATACTTTGAACAGTGCCAGG + Intronic
1165830521 19:38728219-38728241 CAGGCAGACAGGACAGTGGCGGG - Intronic
1166040453 19:40199143-40199165 CTGACAGATGGGACAGTGCATGG - Intronic
1167860127 19:52276446-52276468 CAGACAGAGTATACAGTGCATGG - Intronic
1168471932 19:56647003-56647025 CAGAAAGAGTGGAAAATGCCAGG + Intronic
925695306 2:6571028-6571050 CAGGCAGTTTGGTCACTGCCTGG - Intergenic
927186384 2:20485446-20485468 CAGACAGAGAGCCCAGTGCCAGG - Intergenic
929149563 2:38735490-38735512 TAGACAGATTTATCAGTGCCTGG - Intronic
934307689 2:91840521-91840543 CAGACAGAATCTACACTGCCTGG + Intergenic
938115691 2:128601816-128601838 CAGACAGATAAGAACGTGCCTGG - Intergenic
938290101 2:130144538-130144560 CAGACAGGTTCGGCACTGCCCGG + Intronic
938292244 2:130156383-130156405 CAGACAGGTGGGACAGGGCAGGG + Intronic
938464306 2:131516584-131516606 CAGACAGGTGGGACAGGGCAAGG - Intergenic
939045763 2:137247947-137247969 AGGACAGATGGAACAGTGCCAGG + Intronic
939948181 2:148435857-148435879 CAGACAGAATGGAAAGAGACAGG - Intronic
945414296 2:209552372-209552394 CAGACATTTAGCACAGTGCCAGG + Intronic
946030521 2:216700218-216700240 CAGACAGATAGGGCAGAGCAGGG + Intergenic
946046743 2:216827631-216827653 CTGACAGATTGCTAAGTGCCAGG + Intergenic
948094421 2:235322101-235322123 CAGAGAGATACGGCAGTGCCCGG + Intergenic
948146968 2:235715385-235715407 CAGACAGCCTTGACAGTGGCTGG - Intronic
948930329 2:241127839-241127861 GAGAGAGATTGGAGAGTCCCTGG + Intronic
1169211847 20:3770217-3770239 CAGACACATTGGGCAGTGATGGG - Intergenic
1170694705 20:18647816-18647838 CAGATAGATTGGACTGGGCAAGG + Intronic
1171202814 20:23255688-23255710 AAGCCAGATTGGACTGTGCTAGG + Intergenic
1171227124 20:23451231-23451253 CCCACAGATGGGCCAGTGCCAGG + Intronic
1171419928 20:25011336-25011358 CAGACACAGTGGACCATGCCCGG + Intronic
1173530715 20:43767200-43767222 CAGACAGTTTGGAAAGGTCCTGG + Intergenic
1175514735 20:59561821-59561843 CACACAGAATCGACAGTGTCAGG + Intergenic
1175674699 20:60936661-60936683 CAGACGGATGGGAGAGTGTCTGG - Intergenic
1175746177 20:61459009-61459031 CAGACAGAATAGACAATGCCAGG - Intronic
1178809516 21:35868486-35868508 AAGGCAGATTGGTCATTGCCAGG - Intronic
1179250386 21:39666935-39666957 AGGACAGATTGGAAAGTGGCAGG - Exonic
1179469200 21:41599260-41599282 CAAACACATTGCACAATGCCAGG - Intergenic
1180032405 21:45221552-45221574 TAGCCAGAAGGGACAGTGCCCGG + Intronic
1180069137 21:45427454-45427476 CACACAGTCTGGTCAGTGCCAGG - Intronic
1180244260 21:46536256-46536278 CAGGCAGAAAGGACAGAGCCTGG - Intronic
1180534769 22:16387603-16387625 CAGACAGAATCTACACTGCCTGG + Intergenic
1180969469 22:19807625-19807647 CAGCCACCTTGGACAGAGCCTGG + Intronic
1182045654 22:27272021-27272043 CAGGCCGCTGGGACAGTGCCTGG - Intergenic
1182464383 22:30505488-30505510 CAGCCGGGTTGGGCAGTGCCAGG + Intronic
1183161243 22:36114749-36114771 CAGACAGGCTGGACAATGACTGG + Intergenic
1183894250 22:40955194-40955216 CATTCAGATTGGACAGTGCTGGG - Intronic
1184658632 22:45955179-45955201 GGGTCAGACTGGACAGTGCCCGG - Intronic
1185246734 22:49776749-49776771 CAGACAGCCTTGACAGTGCCTGG + Intronic
950647496 3:14386044-14386066 ATGACACTTTGGACAGTGCCCGG - Intergenic
951420647 3:22480192-22480214 CAGACACATGCCACAGTGCCTGG + Intergenic
956185972 3:66562307-66562329 CACACACATTTGACAGTGTCTGG - Intergenic
956576029 3:70753739-70753761 CAGACAGATTGGAGAGAGTGAGG + Intergenic
961205296 3:125076670-125076692 CAATCTGATTGGCCAGTGCCTGG + Intergenic
961618527 3:128204662-128204684 AAGCCAGGTTGCACAGTGCCTGG + Intronic
962539529 3:136364644-136364666 CAGACATCTTCGACAGTGACTGG + Intronic
962981992 3:140498918-140498940 CAGACAGAGTGCTCAGTGCTGGG - Intronic
967398936 3:189039349-189039371 CTGAAAGTTTGGAGAGTGCCAGG - Intronic
969409792 4:7020404-7020426 CAGTTAGATTAGACAGTGCTAGG - Intronic
974828520 4:67160359-67160381 CAGACAGATGTGACAGCGGCTGG - Intergenic
975541439 4:75516095-75516117 CTAACACATAGGACAGTGCCTGG - Intronic
976842957 4:89453115-89453137 CAGACAGATGGGACATTGATTGG - Intergenic
977637220 4:99313273-99313295 CACAGAAACTGGACAGTGCCTGG - Intronic
977715210 4:100174498-100174520 CAGACAGATTGGTTACAGCCTGG - Intergenic
978630073 4:110733937-110733959 GAGACAGATTGACCTGTGCCAGG - Intergenic
980095002 4:128480432-128480454 CAAACACCTAGGACAGTGCCTGG + Intergenic
981317057 4:143350201-143350223 CAGACAGAAGGCACAGTGCTTGG - Intronic
984873207 4:184345497-184345519 CAGACACATAGCACAATGCCTGG - Intergenic
984935215 4:184883820-184883842 AAAACAGATAGCACAGTGCCAGG + Intergenic
985316526 4:188663838-188663860 CAGACACATAGGAGAATGCCAGG - Intergenic
986101173 5:4613043-4613065 CAGACAGAGGTGACAGAGCCTGG + Intergenic
986132672 5:4945154-4945176 CTGACAGCTAGGACAGAGCCAGG - Intergenic
992102149 5:73418381-73418403 CACACAGTTTGATCAGTGCCAGG + Intergenic
995298277 5:110545355-110545377 CAGATACTTTGTACAGTGCCTGG + Intronic
995456331 5:112356390-112356412 CAGACAGATTGGAAAGTGACTGG + Intronic
997396233 5:133562135-133562157 CATCCAGATTTGACAGTGCCTGG - Intronic
997688928 5:135812581-135812603 CAGACACATTGGAGAGTCCTAGG - Intergenic
998432532 5:142078505-142078527 CAGACAGATGTGTGAGTGCCTGG - Intergenic
1001294351 5:170488754-170488776 CAGCCAGATGGAACAGAGCCCGG + Intronic
1001710920 5:173777360-173777382 CAGAGACACTGGAAAGTGCCAGG + Intergenic
1002086218 5:176777211-176777233 CAGGCAGATCTGACTGTGCCGGG + Intergenic
1002535821 5:179874822-179874844 CAGGCTGACTGGACAGTGCCCGG + Intronic
1005072089 6:21871314-21871336 CACATAGATTGGGCAGGGCCTGG - Intergenic
1006679615 6:35787624-35787646 CAGGCAGATGGGTCAGTGACAGG + Intronic
1010101423 6:72112512-72112534 CAGGCAGATAGGACAGTGACAGG - Intronic
1011811023 6:91132606-91132628 CAAGCAGATTGGAGAGAGCCTGG + Intergenic
1012783804 6:103597353-103597375 CAGACAGAAGGGTCAGTGCCAGG - Intergenic
1013487257 6:110608813-110608835 CAGACATAGTGGCCTGTGCCTGG + Intergenic
1014137235 6:117904573-117904595 TAAACAGATTAGTCAGTGCCTGG + Intergenic
1014426824 6:121316962-121316984 CAGAAAGATGGGCCAGTGGCTGG - Intronic
1017740004 6:157398136-157398158 GAGACAGAGTGGACAGTGACTGG + Intronic
1018393131 6:163355868-163355890 CAGAGAGACTGGACTGTGACAGG + Intergenic
1018959188 6:168434630-168434652 CAGACAAATAGCATAGTGCCTGG - Intergenic
1021554252 7:21903709-21903731 GCGACAGCTTGCACAGTGCCAGG + Intronic
1021965798 7:25916589-25916611 AAGATAGATTGAAGAGTGCCAGG - Intergenic
1023107811 7:36779894-36779916 GATACAGATGTGACAGTGCCCGG + Intergenic
1023355364 7:39361981-39362003 CAGCCACATAGGACAGTGCCAGG + Intronic
1024352824 7:48384556-48384578 CAGATACCCTGGACAGTGCCTGG + Intronic
1031900810 7:127408676-127408698 CAGAGAGATTTGACCCTGCCAGG + Intronic
1032740179 7:134730804-134730826 CAGACAGGCTGGAATGTGCCTGG + Intergenic
1034227687 7:149496580-149496602 CAGAGAGACGGGACAGTGCAGGG - Intronic
1034242861 7:149623622-149623644 CAGAGAGACGGGACAGTGCAGGG - Intergenic
1035034906 7:155888418-155888440 CCGACACACTGGACACTGCCAGG - Intergenic
1035311136 7:157969721-157969743 TAGACAGATTGGGCTGTGCATGG + Intronic
1037014625 8:13886826-13886848 TAGACAGATTTACCAGTGCCTGG + Intergenic
1037024812 8:14022078-14022100 CAGAAAGGTTGGATAGTGCTGGG - Intergenic
1037215564 8:16447099-16447121 CAGAGAAATTGCACAGTGACTGG - Intronic
1039449179 8:37657940-37657962 CAGAAAGATTGGAAAGAGCAAGG + Intergenic
1039464291 8:37772803-37772825 CAGACAAAGTGAACAGTTCCTGG + Exonic
1039553655 8:38461183-38461205 CATACAGGGTGGACAGTGTCTGG + Exonic
1040354126 8:46599612-46599634 CAGAAAGATTGGTGATTGCCAGG + Intergenic
1041751192 8:61262734-61262756 CAGGCAGAGTGCACAGTGACAGG + Intronic
1043921144 8:85984689-85984711 CAGACAGAGTGGACAGATTCTGG + Intergenic
1047706279 8:127502891-127502913 TAGACAGAGTTGTCAGTGCCAGG - Intergenic
1048516968 8:135120104-135120126 CAGACAGCCAGTACAGTGCCTGG - Intergenic
1049668032 8:143856861-143856883 CAGATAGAGTGGACAGGGCTTGG - Intergenic
1049934724 9:490768-490790 CAGACAGTGTGGTAAGTGCCAGG + Intronic
1053127386 9:35593386-35593408 CAGATATATTGGTCAGTTCCAGG - Intergenic
1053447399 9:38163688-38163710 CAAACAGAGTGGACTGTGCCAGG - Intergenic
1054897040 9:70325522-70325544 CAGAAAGGTTGGATAGTGCTGGG + Intronic
1056193769 9:84209619-84209641 CAGACAGTTTTGACAGTGAAAGG + Intergenic
1057200106 9:93135155-93135177 CAGCCTGACTGGACAGAGCCTGG - Intergenic
1058152659 9:101479420-101479442 CAGGCAGTTTGGAAAATGCCAGG + Intronic
1059430551 9:114247653-114247675 CAGGCAGCTTGGACAGTAGCGGG + Intronic
1186349748 X:8730298-8730320 CAGACATCCTGGACAGAGCCAGG - Intronic
1189345234 X:40235998-40236020 CAGGCAGATTGGTGATTGCCAGG - Intergenic
1190443773 X:50502459-50502481 CATACATACAGGACAGTGCCAGG + Intergenic
1191754443 X:64579321-64579343 CAGACAGAAGTGACAGGGCCAGG - Intergenic
1192054638 X:67760561-67760583 CCGACAGGTTGGGGAGTGCCAGG + Intergenic
1193651270 X:84136762-84136784 CATAATGATTGTACAGTGCCTGG - Intronic
1197606272 X:128588944-128588966 AAGACAGATTGGTCATTGCAGGG - Intergenic