ID: 912167753

View in Genome Browser
Species Human (GRCh38)
Location 1:107060339-107060361
Sequence ACCAGTCCATACAGACAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912167753_912167756 7 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167756 1:107060369-107060391 GCTTGGTGCCATTGGACCACAGG 0: 1
1: 0
2: 0
3: 3
4: 86
912167753_912167757 11 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG 0: 1
1: 0
2: 5
3: 102
4: 2799
912167753_912167754 -10 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167754 1:107060352-107060374 ATGGACTGGTACTGACTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 108
912167753_912167761 29 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167761 1:107060391-107060413 GCAGGAACTACCAGGCCCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 148
912167753_912167759 21 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167759 1:107060383-107060405 GACCACAGGCAGGAACTACCAGG 0: 1
1: 1
2: 10
3: 73
4: 645
912167753_912167755 -1 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167755 1:107060361-107060383 TACTGACTGCTTGGTGCCATTGG 0: 1
1: 0
2: 2
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912167753 Original CRISPR ACCAGTCCATACAGACAGAT TGG (reversed) Intergenic
900489400 1:2939409-2939431 TCCAGTCCATCCCCACAGATGGG + Intergenic
904903886 1:33879341-33879363 AGCAGACCAACCAGACAGATGGG - Intronic
905215004 1:36400768-36400790 ACCACTGCACACAGCCAGATAGG + Intergenic
912167753 1:107060339-107060361 ACCAGTCCATACAGACAGATTGG - Intergenic
917361203 1:174178101-174178123 AACAGTCCATACTCACGGATAGG - Intronic
919534361 1:198768422-198768444 AAGAATCCATACAGAAAGATTGG - Intergenic
921446696 1:215255268-215255290 ACCAATCAACACAGACAGAATGG + Intergenic
922955886 1:229599479-229599501 GCAAGTCCATAGAGACAGAGAGG - Intronic
1068383142 10:56285872-56285894 ACCAGTATATACTTACAGATAGG - Intergenic
1070049503 10:72873617-72873639 ACAAGTCAAAATAGACAGATGGG - Intronic
1074942778 10:118251188-118251210 CCCAATCCATACAGACATTTAGG + Intergenic
1076800498 10:132825877-132825899 ACCAGGACATGCAGACAGACAGG + Intronic
1078192567 11:9104054-9104076 ACCTGTACAGCCAGACAGATAGG - Intronic
1078928389 11:15894480-15894502 ACCAGGCCACACAGATAGAGGGG - Intergenic
1081040008 11:38198500-38198522 ACCACACCCTACAGGCAGATGGG - Intergenic
1081218569 11:40432331-40432353 ACCAGTACATAGGGAGAGATTGG - Intronic
1084379468 11:68802065-68802087 GCAAATCCATACAGACAGACAGG + Intronic
1087257207 11:95969357-95969379 ACAAATCCATAGAGACAGAAAGG - Intergenic
1087285527 11:96261079-96261101 ACCTGTCAATACTGCCAGATTGG - Intronic
1089165188 11:116470491-116470513 ACCTGTCCATGCGGAGAGATGGG + Intergenic
1090992426 11:131830790-131830812 AACAGTCCATGCTCACAGATTGG - Intronic
1091744740 12:2983905-2983927 ACCAGTCCTTACTGGGAGATGGG + Intronic
1091747311 12:3000585-3000607 ACCTGTCCATACTGCCACATGGG + Intronic
1098839586 12:75462740-75462762 ACAATTCCATGCTGACAGATAGG - Intergenic
1098935417 12:76473145-76473167 ACCAGGCCACACAGAGAGATAGG - Intronic
1099077883 12:78134597-78134619 CCCAGTCCAGCCAGACACATTGG + Intronic
1102179643 12:110902627-110902649 ACCTGTCCATAGAGACAAATTGG - Intronic
1103949393 12:124542844-124542866 AGCAGTCCAGACAGCCAGAGCGG + Intronic
1108514481 13:51187119-51187141 ACTAGTTCATACAGAAAGACAGG - Intergenic
1108908340 13:55508470-55508492 ACCAGTCCAGAAAGACTGATTGG + Intergenic
1129969572 15:79766301-79766323 ACCAGTCCAGACCTACAAATGGG - Intergenic
1137274379 16:46923881-46923903 CCAAGTCCATACAGACTGACAGG + Intronic
1139524247 16:67503890-67503912 CCCAGTCCTCACAGGCAGATAGG - Intergenic
1142912097 17:3102952-3102974 ACCATTCCGGACAGACAGAGTGG - Intergenic
1143738062 17:8927790-8927812 ACCAAGCCATTCAGAGAGATTGG - Intronic
1144660266 17:17063564-17063586 AACAGTCGATGCAGACAGGTGGG - Intronic
1145400875 17:22531363-22531385 ACCAGTAGATAGAGACATATAGG - Intergenic
1151355994 17:73558863-73558885 ACCAGTCCCTACAGAATGAGAGG + Intronic
1151943112 17:77305111-77305133 GCCAGTCCCTCCAGACAGAAAGG - Intronic
1153258366 18:3196459-3196481 ACCAGTCCATACATATTGTTTGG - Intronic
1159853592 18:73557250-73557272 CCAAGTCCAGAGAGACAGATGGG - Intergenic
1161076113 19:2286598-2286620 CCCAGTCCTCACTGACAGATGGG - Intronic
1162774271 19:12969615-12969637 CCCAGTCCGGACAGACAGACAGG + Exonic
1167736312 19:51296523-51296545 TCCAGGTCAGACAGACAGATGGG + Intergenic
929032102 2:37658723-37658745 GACAGTCCAGACAGACTGATAGG - Intronic
929223807 2:39491978-39492000 ACTAGTCCAAACATATAGATGGG - Intergenic
936880003 2:117238792-117238814 ACCATTCCATGCTTACAGATTGG + Intergenic
937295807 2:120809312-120809334 ACAAATCCATAGAGACAGAAGGG + Intronic
942482384 2:176403217-176403239 ACCAATACATACAAACAGCTTGG - Intergenic
943676053 2:190717449-190717471 TCCAGTCCATATAAACAGATCGG + Intergenic
946471820 2:219967461-219967483 ACCAGAGCACACAGAAAGATGGG - Intergenic
947769350 2:232658699-232658721 GCAAATCCATACAGACAGAAAGG + Intronic
948137985 2:235651461-235651483 AACAGCCCATACAAATAGATTGG + Intronic
1171450541 20:25232966-25232988 GCCCGTCCACAGAGACAGATTGG + Intergenic
1174906879 20:54561204-54561226 ACCAGTGCATCCAGGCAGAGGGG - Intronic
1176216844 20:63952073-63952095 ACCTGTGGACACAGACAGATGGG - Intronic
1178980262 21:37257837-37257859 AACAGTCCAGACAGAACGATGGG + Intronic
1181005787 22:20012823-20012845 CCCAGGCCACACAGCCAGATTGG + Intronic
1181104262 22:20564138-20564160 GCCAATCCATAGAGACAGAGAGG + Intronic
1185058784 22:48594766-48594788 AGCAGTGCAGACAGACGGATGGG + Intronic
951320210 3:21235522-21235544 AGCAGTCCTTACAGAAAAATTGG - Intergenic
953810786 3:46111075-46111097 ACCAGTCCAAACACAAAGAATGG + Intergenic
954695441 3:52422292-52422314 CCTTGTTCATACAGACAGATGGG - Exonic
957778184 3:84783360-84783382 ACAAATCCATAGAGACAGAGTGG + Intergenic
958029290 3:88087807-88087829 ACCAGGCCTTACGGACAGGTTGG + Intronic
968508222 4:982213-982235 CCCAGTGCATACAGGCAGCTGGG - Intronic
970722010 4:18999009-18999031 GACAGTCCATTCAGACAGTTGGG - Intergenic
972222587 4:36972915-36972937 ACCAGACAATACATAAAGATGGG + Intergenic
976057139 4:81081732-81081754 ACCAGCCCATGAAGACAGCTGGG + Intergenic
977736734 4:100426255-100426277 ACCAGCACAAACAGAGAGATGGG - Intronic
978293967 4:107181439-107181461 ACCACTCCAGAAAGGCAGATTGG + Intronic
981962157 4:150553663-150553685 ACAATTACACACAGACAGATGGG + Intronic
984441061 4:179771384-179771406 ACCAGTCCAGACGGAAAGGTAGG + Intergenic
985855012 5:2417741-2417763 CCCAGTGCATAGAGTCAGATGGG - Intergenic
990069697 5:51765497-51765519 ACCAGTGTATTCAGACAAATTGG + Intergenic
993399785 5:87434675-87434697 ACAGGGCCATAAAGACAGATTGG - Intergenic
995890715 5:116947605-116947627 ATTAGTCCATAGAGACAGAAAGG + Intergenic
1009747341 6:67834304-67834326 AGTAGCCTATACAGACAGATGGG + Intergenic
1011946447 6:92910339-92910361 AACAGCACATACAGACAAATAGG - Intergenic
1015955134 6:138590618-138590640 GGGAGTCCATACAGACAGGTTGG - Intronic
1016843645 6:148548855-148548877 ACCAGTACACAGAGACAGACTGG - Exonic
1019847862 7:3524498-3524520 AACAGGCCTTACTGACAGATGGG + Intronic
1020124620 7:5526591-5526613 ACCTGTTCATCCAGACAGAGGGG - Intergenic
1028508968 7:91601092-91601114 ACCATTGCATACAGACCGACTGG - Intergenic
1038601915 8:28952625-28952647 ATCAGTCCAGCCAGACAAATAGG + Intronic
1040756004 8:50776049-50776071 ACCAATCAATACACAGAGATTGG - Intronic
1044165377 8:88976057-88976079 ACCATTCAGTACAGAGAGATTGG + Intergenic
1046783511 8:118241105-118241127 TGCAGACCATAAAGACAGATGGG - Intronic
1047710506 8:127547183-127547205 ACTAGTCCATGCAGCAAGATGGG + Intergenic
1048225085 8:132577448-132577470 ATCAGTACATACAGAAATATAGG + Intronic
1051435041 9:17021653-17021675 ACCAGGCAATACAGAAAGTTAGG - Intergenic
1055579252 9:77690801-77690823 ACCAGTCCATAAAGGCAGCCAGG - Intergenic
1057072339 9:92110065-92110087 ACCAGTAGATAGAGACACATGGG - Intronic
1058658734 9:107249279-107249301 ACCAGTACATACAGAGAGAGAGG + Intergenic
1061761654 9:132855858-132855880 CCCAGACCATACAGGCAGAAGGG - Intronic
1061761772 9:132856513-132856535 CCCAGACCATACAGGCAGAAGGG - Intronic
1192067724 X:67904037-67904059 GCCAGTCCAAACACACTGATGGG + Intergenic
1194431545 X:93813244-93813266 ACCACTACATAGAAACAGATGGG + Intergenic
1194785613 X:98080638-98080660 ACCAGCCTACACAGAGAGATTGG + Intergenic
1195907785 X:109862779-109862801 CCCAGGCCATACAGATAGAGTGG + Intergenic
1199842016 X:151659032-151659054 GCAAGGCCATACAGACAGACAGG - Intronic