ID: 912167757

View in Genome Browser
Species Human (GRCh38)
Location 1:107060373-107060395
Sequence GGTGCCATTGGACCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2907
Summary {0: 1, 1: 0, 2: 5, 3: 102, 4: 2799}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912167753_912167757 11 Left 912167753 1:107060339-107060361 CCAATCTGTCTGTATGGACTGGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG 0: 1
1: 0
2: 5
3: 102
4: 2799
912167750_912167757 22 Left 912167750 1:107060328-107060350 CCAGGCACTGTCCAATCTGTCTG 0: 1
1: 0
2: 1
3: 17
4: 222
Right 912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG 0: 1
1: 0
2: 5
3: 102
4: 2799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912167757 Original CRISPR GGTGCCATTGGACCACAGGC AGG Intergenic
Too many off-targets to display for this crispr