ID: 912173828

View in Genome Browser
Species Human (GRCh38)
Location 1:107134092-107134114
Sequence CATTGTGACCAGAAAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912173828_912173830 0 Left 912173828 1:107134092-107134114 CCACCTGCTTTCTGGTCACAATG No data
Right 912173830 1:107134115-107134137 TCTTTTGTGTCTTTGTCTGCTGG No data
912173828_912173831 8 Left 912173828 1:107134092-107134114 CCACCTGCTTTCTGGTCACAATG No data
Right 912173831 1:107134123-107134145 GTCTTTGTCTGCTGGATGAACGG No data
912173828_912173832 25 Left 912173828 1:107134092-107134114 CCACCTGCTTTCTGGTCACAATG No data
Right 912173832 1:107134140-107134162 GAACGGCTACTCATATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912173828 Original CRISPR CATTGTGACCAGAAAGCAGG TGG (reversed) Intergenic
No off target data available for this crispr