ID: 912174834

View in Genome Browser
Species Human (GRCh38)
Location 1:107141758-107141780
Sequence CCCTGTCAGTCGGCGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912174834_912174847 28 Left 912174834 1:107141758-107141780 CCTCCATCCGCCGACTGACAGGG 0: 1
1: 0
2: 1
3: 3
4: 59
Right 912174847 1:107141809-107141831 CCTGGCCACACACATCGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 136
912174834_912174843 10 Left 912174834 1:107141758-107141780 CCTCCATCCGCCGACTGACAGGG 0: 1
1: 0
2: 1
3: 3
4: 59
Right 912174843 1:107141791-107141813 CTCCCTCTCTCACGCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912174834 Original CRISPR CCCTGTCAGTCGGCGGATGG AGG (reversed) Intronic
903670839 1:25034462-25034484 CCCTCTGAGGCGGCGGGTGGTGG - Intergenic
904412445 1:30332654-30332676 ACCTGTCAGTGAGCGGATGCTGG - Intergenic
905336026 1:37245054-37245076 CCCTGGCAGTCAGGAGATGGGGG + Intergenic
912174834 1:107141758-107141780 CCCTGTCAGTCGGCGGATGGAGG - Intronic
913069358 1:115285235-115285257 CCCTGGCTGTGGGCTGATGGTGG + Intergenic
1062857406 10:786103-786125 CCCTGTCTGTGTGCGGCTGGAGG - Intergenic
1062926544 10:1320105-1320127 CACTGTGAGTCTGAGGATGGAGG - Intronic
1067765224 10:49080798-49080820 CCCTGTCAGTAGGCTGGTGGGGG + Intronic
1076695276 10:132244368-132244390 CCCTGGCAGTCTACAGATGGTGG + Intronic
1076857573 10:133124779-133124801 CCACGTCAGGCGGTGGATGGTGG + Intronic
1076890052 10:133278982-133279004 CCCTGTCACACTGGGGATGGCGG + Exonic
1077058504 11:607582-607604 GCCAGTCAGTCGGCTGATGCAGG - Exonic
1078124272 11:8544163-8544185 CCGTGCCTGTCGGGGGATGGGGG - Intronic
1080606869 11:33870638-33870660 TCCTCTCAGTCGGCTGGTGGCGG + Intronic
1084177672 11:67431887-67431909 CCCTGAGAGTGGACGGATGGAGG - Intronic
1089703369 11:120259275-120259297 CCCTGACAGTCTGTGGATTGGGG - Intronic
1091080302 11:132660793-132660815 CCATGACAGTCGGCTGATGGAGG + Intronic
1119180608 14:72602545-72602567 CACTGTGAGTCGGCCGGTGGAGG - Intergenic
1122114257 14:99520052-99520074 CCCTGACAGCCAGTGGATGGAGG + Intronic
1135207576 16:20495605-20495627 CCCTCTCACTCCGTGGATGGAGG + Intergenic
1135211309 16:20528027-20528049 CCCTCTCACTCCGTGGATGGAGG - Intergenic
1137891134 16:52162972-52162994 CCCTGTGAGTCGGGGCTTGGTGG + Intergenic
1138779642 16:59767442-59767464 GCCTGTCAGTCAGGGGACGGGGG - Intergenic
1142831685 17:2553840-2553862 CCCTGTCTGTCGGAGGAAGACGG - Intergenic
1148503203 17:48107509-48107531 CCCTGACAGTGGGCGGAACGCGG + Intronic
1149979905 17:61302170-61302192 CCCTGGGAGTCGGGGGAGGGGGG - Intronic
1156394499 18:36686480-36686502 GCCTGTCAGTGGGGGGATTGGGG + Intronic
1160915751 19:1495750-1495772 CCCTGTCCGGGGGCTGATGGTGG + Intronic
1161318651 19:3631134-3631156 CCGTGTCACTCAGCGGAGGGAGG + Exonic
1166593688 19:44025792-44025814 CCCTGTCACTCGGTGTCTGGTGG + Intronic
1168378696 19:55901996-55902018 CCCTCTGAGTTGGCAGATGGAGG - Intronic
1168554529 19:57326872-57326894 CCCTGTCTGAAGGCGGGTGGGGG - Intronic
925322679 2:2987734-2987756 CCCTGTCAGAGGGTGGAAGGTGG - Intergenic
928941594 2:36732553-36732575 CACTGTCAGTCTGCTGCTGGGGG + Intronic
929787590 2:45003642-45003664 CCCTGTCAGTCAGCAGAAGTTGG + Intergenic
940181155 2:150934726-150934748 CCCTGCCTGTAGGCAGATGGGGG - Intergenic
945088675 2:206159176-206159198 CCCTGAGAGCCGGCAGATGGGGG - Exonic
1169065986 20:2694230-2694252 CCCTCAGAGTTGGCGGATGGGGG + Intronic
1173970754 20:47150472-47150494 CCCTGTCTTTCGGGGGGTGGGGG - Intronic
1181055059 22:20256908-20256930 CCCTGGCAGTGGGCAGAAGGTGG - Intronic
951801061 3:26596468-26596490 CCCTGTCAGTCACCGGATGGTGG + Intergenic
951881519 3:27484624-27484646 CCCAGCCAATCGGCGGCTGGCGG + Intergenic
952693860 3:36242780-36242802 GCCTGTCAGACGGTGGAGGGTGG + Intergenic
956272652 3:67464195-67464217 CCCTGTCAGTCAGAGCATGGAGG - Intronic
966933647 3:184691644-184691666 CCCTGGCAGCCCGCAGATGGGGG - Intergenic
980990531 4:139735315-139735337 CAGTGTCAGTCGGAGGAGGGGGG - Intronic
990095809 5:52110903-52110925 CCCTGTGGGTTGGGGGATGGGGG - Intergenic
997928629 5:138053911-138053933 CCCTGTCAGTTGGGGGTGGGAGG + Intergenic
999263328 5:150250867-150250889 CCCTGCCAGTCAGGGGCTGGGGG - Intronic
999824149 5:155258133-155258155 CCCTGTTAGTTGCTGGATGGTGG + Intergenic
1000995416 5:167953520-167953542 ACCTGTCAGTCAGGGTATGGAGG + Intronic
1001472815 5:172026938-172026960 CCCTGTCAGGCAGGGCATGGTGG - Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1010940767 6:81915169-81915191 CCCTGACAGTGGGGGGAAGGGGG - Intergenic
1013394522 6:109721423-109721445 CCCTGTTAGTGGGCTGATGAGGG + Intronic
1017908090 6:158770433-158770455 CCCTGTCAGTCATGGGCTGGGGG + Intronic
1020142450 7:5620002-5620024 CCCTGTAACTTGCCGGATGGCGG + Intergenic
1022181880 7:27928779-27928801 GCCTGTCAGAGGGCGGAGGGTGG + Intronic
1022685356 7:32591323-32591345 CCCTGTCAGCCCGCGGACAGGGG + Intergenic
1038525537 8:28269996-28270018 CCCTGTCAGAGGGTGGAGGGTGG + Intergenic
1041030122 8:53728255-53728277 CCCTGTAAGGCTGAGGATGGAGG - Intronic
1194065512 X:89255868-89255890 GCCTGTCAGAGGGAGGATGGAGG - Intergenic
1197804246 X:130384294-130384316 ACCTGTCAGTCTGGGGGTGGGGG + Intergenic
1200719681 Y:6589963-6589985 GCCTGTCAGAGGGAGGATGGAGG - Intergenic