ID: 912175042

View in Genome Browser
Species Human (GRCh38)
Location 1:107144367-107144389
Sequence TCATAAATATTCAGCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912175042 Original CRISPR TCATAAATATTCAGCTTTTC AGG (reversed) Intronic
900232121 1:1564830-1564852 TCATAAACATTGGGCTTGTCGGG + Exonic
901696577 1:11012453-11012475 TTTTCAATCTTCAGCTTTTCAGG + Exonic
902143084 1:14373186-14373208 ATATATATATTCAGTTTTTCAGG - Intergenic
902208874 1:14890463-14890485 TTAAAAATGTTCAGCTTTTAGGG - Intronic
906806512 1:48783882-48783904 TCATAAATATTATTATTTTCAGG + Intronic
908271457 1:62426604-62426626 AGGTAAAAATTCAGCTTTTCTGG - Intergenic
909161685 1:72159206-72159228 TCTTAAATACTCTGCTTCTCTGG - Intronic
909410330 1:75342805-75342827 TCAGAAAATGTCAGCTTTTCAGG - Intronic
912175042 1:107144367-107144389 TCATAAATATTCAGCTTTTCAGG - Intronic
913044827 1:115064957-115064979 TCTGAAATAATGAGCTTTTCAGG + Intronic
913555699 1:119964878-119964900 GCACAAATATTCTGCATTTCTGG - Intronic
915959273 1:160251237-160251259 TCATAAATGAGCAGCTGTTCAGG + Intronic
916791032 1:168125518-168125540 TCAAAAAAATTCATATTTTCTGG - Intronic
916826442 1:168446229-168446251 TCATGAATATTCTACTTCTCTGG + Intergenic
917466368 1:175280485-175280507 ACATAAATTTTCAGCTTAACTGG - Intergenic
918921517 1:190717269-190717291 TAATTAATATTCAGCTATCCTGG + Intergenic
919010349 1:191952211-191952233 ACATAAATATGAAGCTATTCAGG - Intergenic
919071292 1:192758483-192758505 ACATACATTTTCAGCTTTTCTGG + Intergenic
920927472 1:210356306-210356328 TCATTAATATGCAACTTTTCAGG - Intronic
921270674 1:213466625-213466647 TGCTAAATACACAGCTTTTCAGG + Intergenic
922115149 1:222606080-222606102 TAATAAATATAGGGCTTTTCAGG + Intergenic
923399697 1:233604355-233604377 TAATAAATATTCATCCTTTGCGG + Intergenic
924074074 1:240314947-240314969 TAATAACTATTCAGCTCTTCTGG + Intronic
1063617649 10:7615463-7615485 GCATAAATAGTCATATTTTCAGG + Intronic
1064566007 10:16640091-16640113 TCATAATTTTTCTGATTTTCTGG - Intronic
1065825283 10:29565101-29565123 CTTGAAATATTCAGCTTTTCAGG + Intronic
1068442508 10:57076875-57076897 TTATGATTATTCATCTTTTCAGG - Intergenic
1068647473 10:59484097-59484119 TTATAAAAATTTAGCATTTCTGG + Intergenic
1069126043 10:64635287-64635309 TAATAAATATTGGGCTATTCGGG + Intergenic
1069248373 10:66237447-66237469 TATTAAATAGTCAGCATTTCGGG - Intronic
1070185803 10:74061569-74061591 TCATAAATGTTCAAGTTTCCTGG + Intronic
1070337960 10:75471733-75471755 AAATAAACATTCAACTTTTCAGG - Intronic
1071131699 10:82401098-82401120 TCATAGATATTCTGCATTCCAGG - Intronic
1071852309 10:89586372-89586394 CCATAAATAATCAGGTATTCTGG + Intronic
1072303677 10:94086404-94086426 TCATAAATATCCATCTTTAAAGG - Intronic
1074375147 10:112934359-112934381 TCATAACTGTTCTGCTTTGCTGG - Intergenic
1075369710 10:121925727-121925749 TCATAATTAATCAGGTTTTGTGG + Intronic
1078184629 11:9041278-9041300 TCTTAAATGTTCAGCATCTCTGG + Intronic
1079944759 11:26728082-26728104 CCATTAGAATTCAGCTTTTCAGG + Intergenic
1081041248 11:38217073-38217095 TAATCAATATTCATCTATTCAGG + Intergenic
1081402474 11:42659057-42659079 TGATAAAGAGTCAGCTCTTCTGG - Intergenic
1083077978 11:60061236-60061258 ACAGAAGTATTCAGCTCTTCTGG - Exonic
1083406087 11:62458216-62458238 TAAAAAAATTTCAGCTTTTCAGG - Intronic
1085540342 11:77262006-77262028 TCATAACTATTTAGCTTATTTGG - Intronic
1085946015 11:81274479-81274501 TTGTAAAAATACAGCTTTTCAGG + Intergenic
1086063470 11:82723497-82723519 TCATGACTAATTAGCTTTTCAGG - Intergenic
1086507895 11:87524952-87524974 TCATAAATATTCAGCATGTTTGG + Intergenic
1086564910 11:88214381-88214403 TTATAATTAGTCAGTTTTTCAGG - Intergenic
1086794314 11:91081687-91081709 TCACAAATATTAATCTTTTCTGG + Intergenic
1087265889 11:96060460-96060482 ACATAAATAGTGATCTTTTCTGG - Intronic
1089720865 11:120419865-120419887 ACATATATTTTCAGCTTTGCAGG - Intronic
1090325001 11:125877849-125877871 TCAAGAATATTAAGCTTTTTGGG - Intergenic
1092888386 12:12945883-12945905 CAATCAATATACAGCTTTTCAGG + Intronic
1093551280 12:20414972-20414994 TCATAAAGATTAAACTTTACAGG + Intronic
1093635687 12:21464658-21464680 ACATATATATTTAACTTTTCTGG - Intronic
1093954325 12:25198770-25198792 TCATACATTTACTGCTTTTCTGG - Intronic
1094256294 12:28431550-28431572 TCATTAATTTTCAGTTTTTCTGG + Intronic
1096759623 12:53829832-53829854 TCCAAAAGATCCAGCTTTTCAGG - Intergenic
1097112924 12:56675569-56675591 CAGTAAATATTCAGCTTTGCAGG - Intronic
1098423206 12:70327035-70327057 TCATAAAAATTTATCATTTCAGG - Intronic
1098682091 12:73369188-73369210 TCATAAATGCTCACTTTTTCTGG + Intergenic
1099027404 12:77482794-77482816 TCTTAAATCTTCATCCTTTCTGG - Intergenic
1099462146 12:82936802-82936824 CCATTAATATTCAGCTTCTTGGG + Intronic
1099983598 12:89636419-89636441 TTATAAGTAATCAGCGTTTCAGG - Intronic
1100215718 12:92446045-92446067 TCTTGAAAATTCAGCTGTTCTGG - Intergenic
1100912569 12:99382385-99382407 TCAAAGAGATGCAGCTTTTCTGG + Intronic
1104565844 12:129881559-129881581 TCATAAATTTTCAGATGTTTGGG - Intronic
1104878844 12:132055365-132055387 TCAGAAACATTCAGCTGTTTAGG + Intronic
1108552873 13:51563994-51564016 TTATAAAAATTCAGGTTCTCAGG + Intergenic
1108816664 13:54301022-54301044 TCATACATTTTCATATTTTCAGG + Intergenic
1108853091 13:54759714-54759736 TCATAATTATTCATGTTTTCTGG + Intergenic
1110099514 13:71579541-71579563 TCATAATTATCCAGTTTCTCAGG - Intronic
1110169178 13:72480109-72480131 TCCTAAATATTTAGTTTTTTTGG - Intergenic
1110266276 13:73541504-73541526 GCAAATATTTTCAGCTTTTCAGG + Intergenic
1111047970 13:82840654-82840676 TCAAAGAGATTCACCTTTTCTGG - Intergenic
1111052828 13:82907678-82907700 TCTTTAATGTTCAGCCTTTCTGG - Intergenic
1111724858 13:91994239-91994261 TCATAAAAATTTTCCTTTTCAGG - Intronic
1112008664 13:95275985-95276007 TTCTAAATATGCAGCTATTCAGG - Intronic
1112664116 13:101549959-101549981 TCATAAATATTCTTCCTTACAGG - Intronic
1113014075 13:105807508-105807530 ACATAAACATTCATTTTTTCTGG - Intergenic
1114833473 14:26174681-26174703 TCTTAAATATTCATCTTATTTGG + Intergenic
1114867961 14:26620972-26620994 GCATACATATTAAGCATTTCAGG + Intergenic
1115627119 14:35204793-35204815 TCAGAAATATTAAGCCTTTATGG + Intronic
1115810066 14:37097497-37097519 TCATAAATATCCATATTCTCAGG + Intronic
1116140269 14:40984465-40984487 ATATAAATATCCAGTTTTTCCGG + Intergenic
1116664808 14:47760852-47760874 TCATAAATTGTAAGCATTTCAGG + Intergenic
1117302118 14:54440505-54440527 TCAGAAACCTTAAGCTTTTCTGG - Intronic
1117618300 14:57557202-57557224 TCATTAATGTTCAGCTTCCCAGG + Intergenic
1119463880 14:74837216-74837238 GCTTAAAAATTCAGATTTTCAGG - Intronic
1119574475 14:75706296-75706318 ACCTAAATATTAAACTTTTCAGG + Intronic
1119588217 14:75858652-75858674 TGATAAAATTACAGCTTTTCAGG + Intronic
1119760223 14:77145511-77145533 TCATCGATATTTAACTTTTCTGG + Intronic
1120265497 14:82244393-82244415 ACTTAAATATACAGCTTTTCAGG - Intergenic
1120713236 14:87814885-87814907 TAATAAATATGCTGCTATTCAGG - Intergenic
1122427217 14:101618408-101618430 TCATGATTATTCAGTTTTTGTGG - Intergenic
1125379844 15:39075987-39076009 TCTTAAATTTTCAGCTCTCCTGG - Intergenic
1127231001 15:56995067-56995089 ACATACATATTTAACTTTTCAGG - Intronic
1129021188 15:72520399-72520421 TTTTAAATATTCAACCTTTCTGG + Intronic
1131224696 15:90614562-90614584 TAATAAATATTCATGTTTTCAGG + Intronic
1131579155 15:93624797-93624819 TCATAAATATTTACCTTCTTCGG + Intergenic
1132081140 15:98866628-98866650 TCATGAATATTCTGAGTTTCTGG - Intronic
1134353136 16:13456700-13456722 TCATTAGTCTTCAGCTTTTCTGG - Intergenic
1136077912 16:27829458-27829480 TCATAAAAAATGAGCTTTTAGGG - Intronic
1137572995 16:49578815-49578837 CCTGAAATATTCAGGTTTTCAGG + Intronic
1138892315 16:61158847-61158869 ACATAAATATTTATTTTTTCAGG - Intergenic
1140425823 16:74860480-74860502 CCATTAAAAGTCAGCTTTTCAGG + Intergenic
1141554129 16:84826000-84826022 TCATAGAAATGCAGGTTTTCAGG + Intronic
1143221872 17:5268880-5268902 TCATATATATATATCTTTTCTGG - Intergenic
1143725236 17:8839971-8839993 GCATAACTATTCAGATTTTAAGG - Intronic
1144417379 17:15063391-15063413 TCATATATTTTGAGATTTTCCGG - Intergenic
1146405918 17:32537557-32537579 TCATAAATGTTTAGTTTTTAGGG + Intronic
1151116716 17:71743712-71743734 TGAAAAATATACAGCGTTTCAGG - Intergenic
1153379602 18:4423173-4423195 CAATAAATATTCAGTTTCTCTGG + Intronic
1153707645 18:7762609-7762631 TTATAAAAATTCAGCTTGTTGGG + Intronic
1154208669 18:12360139-12360161 TTATAAATTTTCAGTATTTCTGG - Intronic
1155195297 18:23468627-23468649 TAATAAATGTTCAGTCTTTCTGG + Intronic
1155718584 18:28980060-28980082 TTATAGATATAAAGCTTTTCAGG - Intergenic
1156108441 18:33693719-33693741 GCATAAATATTTAGCATTGCTGG - Intronic
1156789857 18:40957772-40957794 TCACAAAGATTCAGCTATCCAGG + Intergenic
1156798764 18:41082003-41082025 TCATAAATATCTATCTTTGCTGG - Intergenic
1156989007 18:43383776-43383798 TTAAAAATATTGAGCTTTTGTGG + Intergenic
1158255770 18:55546732-55546754 TAATAAATTTTCAGCTTTGAAGG + Intronic
1158918566 18:62163554-62163576 TCAAAAAGATTTAGCTTTTAAGG + Exonic
1159166525 18:64708802-64708824 TAATAAAAATTCTGCTGTTCAGG + Intergenic
1159335315 18:67056909-67056931 TCATTCAGATTCAGCTTTCCAGG + Intergenic
1159623104 18:70662003-70662025 TCATAAATATTAACCACTTCAGG + Intergenic
1160342163 18:78098673-78098695 TTATAAATATTCACATTTTTTGG - Intergenic
1164774181 19:30838789-30838811 TCAGAAATTTTGGGCTTTTCTGG - Intergenic
1167139744 19:47641654-47641676 AAATAAAAATTCAGCTATTCAGG + Intronic
1168278140 19:55288178-55288200 TCATAGAAATTGAGCTTTTGGGG + Intronic
1168385342 19:55958632-55958654 GCAAATATATTCAGCTTTGCTGG - Intronic
925070460 2:962963-962985 TCATCAGTATTCACCTTTTCTGG - Intronic
925727387 2:6886744-6886766 ACATATATATTTAGTTTTTCAGG + Intronic
925773950 2:7313591-7313613 ACATAAGTGTTCAGCTCTTCTGG + Intergenic
926182634 2:10659250-10659272 GCATGAATATTTTGCTTTTCAGG - Exonic
926442980 2:12909650-12909672 TCATCAGTATTCTGCTTTTTAGG + Intergenic
926475547 2:13317571-13317593 GCATAAAAATTGAGGTTTTCTGG + Intergenic
926505161 2:13705120-13705142 TGAAAAATATTCAGCTACTCGGG - Intergenic
927461314 2:23300785-23300807 TCATGAATATCCAGCCTCTCAGG + Intergenic
929244919 2:39690739-39690761 TCATAGATATTCACCTCTTTGGG - Intronic
930341001 2:50114514-50114536 ACATAAATTCTCAGCTCTTCTGG - Intronic
930489862 2:52055609-52055631 TGAATAATATCCAGCTTTTCTGG + Intergenic
930525064 2:52518670-52518692 TCATAAATATTCTGGCTTTAAGG - Intergenic
930542251 2:52721200-52721222 TCATATATATTCAGCAGTTTTGG - Intergenic
931796625 2:65716707-65716729 TTATAAACATTCAGCTCTTGAGG - Intergenic
932114081 2:69029641-69029663 TTATAATTATTGAGCTTTTTTGG - Intronic
932639426 2:73428288-73428310 TCATAATTATTCAGCAATTGGGG + Intronic
935041596 2:99434643-99434665 TCACAAATAATTGGCTTTTCTGG - Intronic
935614813 2:105066940-105066962 CAATGAATATTCAACTTTTCTGG - Intronic
937202320 2:120211991-120212013 TCAGAAATATTCTTCTTTGCTGG + Intergenic
938912077 2:135895285-135895307 TTAAAAATATTCAGCTTCCCTGG - Intergenic
939006115 2:136789359-136789381 TAATAAATATACATGTTTTCAGG + Intronic
939031735 2:137084808-137084830 TAACAAATATTCAGATTTCCAGG + Intronic
939761182 2:146182032-146182054 TCTGAAATATTCATCTATTCTGG + Intergenic
940103573 2:150070914-150070936 TCATATATCTTCAGCTCTTTGGG - Intergenic
942020063 2:171858666-171858688 CCATAAATACTCAGTTTTTCTGG + Intronic
942587940 2:177506367-177506389 TAATAAATATACATATTTTCAGG + Intronic
942971788 2:181965512-181965534 ATATAAATATTCAGTTTTCCTGG + Intronic
943464630 2:188213802-188213824 ACATACATTTTCAGCTTTTGTGG + Intergenic
943612701 2:190052260-190052282 TGAAAAGTATGCAGCTTTTCAGG + Intronic
943728566 2:191277671-191277693 ACATTTATATGCAGCTTTTCTGG + Intronic
944098995 2:196001829-196001851 TAATAAATATTCTGCACTTCTGG + Exonic
944765394 2:202859264-202859286 TTATAAATATAAATCTTTTCAGG + Intronic
945654268 2:212604766-212604788 TCATAGATCTGCAGCTGTTCGGG - Intergenic
946738459 2:222777765-222777787 TCATGAATATTCACCTTCTCAGG + Intergenic
947209896 2:227698990-227699012 TCAGAAATACTCAGCACTTCAGG - Exonic
948085631 2:235244422-235244444 GCAGAAATATTCAGCCATTCTGG - Intergenic
1169738494 20:8864238-8864260 TCAGTAATATCCAGCTCTTCTGG + Intronic
1171747911 20:29017481-29017503 TGATAAAGATTCAACTTTACTGG - Intergenic
1173184705 20:40831601-40831623 TCCTAAATATTCATTTTTCCAGG + Intergenic
1173689018 20:44944743-44944765 CAATAACTATTCAGCTTTTTTGG - Intronic
1174575742 20:51535817-51535839 TCATAAATCCTGAGCTTTGCTGG + Intronic
1174664262 20:52242453-52242475 TCTTAAATATTTATCTTTTTTGG - Intergenic
1175510038 20:59517906-59517928 TCATCAATATTTGGTTTTTCTGG + Intergenic
1176317617 21:5262259-5262281 TGATAAAGATTCAACTTTACTGG + Intergenic
1176350520 21:5791393-5791415 TGATAAAGATTCAACTTTACTGG + Intergenic
1176357334 21:5911977-5911999 TGATAAAGATTCAACTTTACTGG + Intergenic
1176544841 21:8189463-8189485 TGATAAAGATTCAACTTTACTGG + Intergenic
1176563792 21:8372508-8372530 TGATAAAGATTCAACTTTACTGG + Intergenic
1176944598 21:14963903-14963925 TCTTAAATATTCAACTTTTCAGG + Exonic
1177070786 21:16504417-16504439 AGACAAATATCCAGCTTTTCTGG - Intergenic
1177655548 21:24011939-24011961 ACATAAATATTCATCTATTGAGG - Intergenic
1178173028 21:30063259-30063281 TCATTACTATTCATCATTTCAGG - Intergenic
1180395292 22:12326610-12326632 TGATAAAGATTCAACTTTACTGG + Intergenic
1180906030 22:19412372-19412394 TCATAATTCTGCAGCTTGTCAGG - Intronic
1181813262 22:25418335-25418357 ACATAAAAATTCAACTTGTCGGG - Intergenic
1182214121 22:28701602-28701624 GCATAAATATTAAGTGTTTCTGG - Intronic
1182406359 22:30135548-30135570 CTTTTAATATTCAGCTTTTCAGG + Intronic
1183566441 22:38618766-38618788 TGATAAATATTCGGCTTTGCAGG + Intronic
1203249711 22_KI270733v1_random:105701-105723 TGATAAAGATTCAACTTTACTGG + Intergenic
949501996 3:4688774-4688796 ACATAAATACTCATCTTTTGGGG + Intronic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
951342195 3:21501916-21501938 TCTTAGGTGTTCAGCTTTTCAGG + Intronic
951664684 3:25109510-25109532 TCAAATATATTTTGCTTTTCAGG - Intergenic
952714528 3:36466010-36466032 TCATAAATATTTATGGTTTCAGG + Intronic
953668154 3:44940758-44940780 TCATATGTATTCAGTTTCTCTGG + Intronic
955951057 3:64242463-64242485 ACATAAATCTTCAGCTTATCTGG + Intronic
957330134 3:78752395-78752417 ACATTAATATTCACCTTTTTGGG + Intronic
957508837 3:81160818-81160840 TCATATATATTCAGATTTCATGG + Intergenic
957998145 3:87717065-87717087 TCATAGATCTTCAGTTCTTCGGG - Intergenic
958044063 3:88262521-88262543 TTAAAAATATTCTGCTTTTTAGG + Intergenic
959745043 3:109766520-109766542 ATATCAATATTCAGGTTTTCTGG + Intergenic
959757394 3:109915111-109915133 TCATAGTTTTTCAGCTTCTCAGG + Intergenic
959799282 3:110472047-110472069 TCATAAATATTGAGCAGTTTTGG - Intergenic
959933593 3:112007951-112007973 TCTTAAATATTCAGATTCTGGGG - Intronic
960521062 3:118655791-118655813 ACAGAGATATTTAGCTTTTCTGG + Intergenic
961019650 3:123494637-123494659 TCATAAATATTAAGAACTTCTGG + Exonic
961927625 3:130498186-130498208 TCACAAAAATTCTACTTTTCAGG - Intergenic
962547932 3:136456166-136456188 TCATAGATCTTCAGTTTTTCTGG - Intronic
962568541 3:136689042-136689064 CCATAAAGAATCTGCTTTTCTGG - Intronic
964731006 3:159864875-159864897 TATTAAAAATTCAGCTCTTCGGG - Intronic
964994192 3:162854333-162854355 TCATAGATCTTCAGTTCTTCTGG - Intergenic
964995700 3:162877405-162877427 TCATAAGTATTAAGTTTTTATGG + Intergenic
965180443 3:165395684-165395706 CCTTAAATGTCCAGCTTTTCTGG + Intergenic
965392051 3:168116916-168116938 TGAAACATGTTCAGCTTTTCAGG - Intergenic
965692570 3:171373036-171373058 TCACAAACATTCAGCTCTCCAGG - Intronic
965896374 3:173582449-173582471 TCATCAATATTAAGTTTTGCTGG + Intronic
966125798 3:176575038-176575060 TGATTATTATTCAGCTTTTGTGG - Intergenic
966161077 3:176969073-176969095 TCATAAATATTCAGTTAATGAGG + Intergenic
966514516 3:180803216-180803238 TCATAATTGTTCAACTTGTCAGG + Intronic
967244546 3:187472084-187472106 TCATAATTATTCTCCTTTTTTGG + Intergenic
967472206 3:189875067-189875089 TAGTAAATATTTAGATTTTCTGG + Intronic
968020401 3:195382215-195382237 TCCTAAATGGTCAACTTTTCTGG - Intronic
968338793 3:197936991-197937013 TAGTAAATATTCGGCTTTGCAGG + Intronic
968716677 4:2165084-2165106 ACATAAATTTTCAGCTTATCTGG - Intronic
970203266 4:13630560-13630582 TCAAATTTATTCAGCTTTTTGGG + Intergenic
970651249 4:18180533-18180555 TGAAAAATCTTCAGTTTTTCAGG - Intergenic
970799324 4:19952894-19952916 TCTTAAAGATTCAGATTTCCAGG - Intergenic
971651340 4:29279334-29279356 TCATAGATCTTCAGCTCTTCTGG + Intergenic
972068231 4:34980019-34980041 TCTTAAACATTTAGTTTTTCAGG - Intergenic
972322756 4:37987862-37987884 TCATAGTTATTCAGCTTACCTGG + Intronic
972923613 4:43975053-43975075 ACATAAATATTCAGTGTCTCAGG - Intergenic
973115743 4:46456108-46456130 TTATAGATCTTCAGTTTTTCTGG - Intronic
973308807 4:48684231-48684253 TCTTAAGTAGTCAGCTTTTTGGG - Intronic
973655697 4:53045136-53045158 TCACAAATATTCAGGTTACCTGG + Intronic
974100919 4:57415345-57415367 TCAAAAATATTCATATTGTCAGG + Intergenic
974468385 4:62286898-62286920 TCAAAATTATCCAGCTTTACAGG - Intergenic
974920946 4:68238318-68238340 TCATATGCATTCATCTTTTCAGG - Intronic
975086998 4:70353706-70353728 ATATCAATATTCAGTTTTTCAGG - Intergenic
976939991 4:90688000-90688022 TTATGAATATCGAGCTTTTCTGG - Intronic
977281540 4:95046046-95046068 GAATAAATATTTAGTTTTTCAGG + Intronic
978652144 4:111018697-111018719 TCATAAAACATCTGCTTTTCAGG + Intergenic
978755102 4:112293289-112293311 TCAAAAATATTAAGCATTTCAGG - Intronic
979062799 4:116086286-116086308 TCATAAATTTTCATCACTTCTGG + Intergenic
979088674 4:116449874-116449896 ACATAAATCATCAGCTTTTCTGG + Intergenic
980089110 4:128423354-128423376 TCATACACATTCACTTTTTCAGG - Intergenic
980619144 4:135274767-135274789 TTCCAAATATTCAGCTTCTCTGG + Intergenic
980981339 4:139656982-139657004 CTATAAAAATTCAGTTTTTCAGG - Intergenic
981128063 4:141129989-141130011 TCACAAATATGCAGATTTTCTGG + Intronic
982978930 4:162105648-162105670 TCAATAATATTCAGCCTTTTTGG + Intronic
984321503 4:178202992-178203014 ACATAAATGTTCAACTTTTGGGG - Intergenic
985162836 4:187062229-187062251 TCATAAAAATTCAGATCTTCAGG + Intergenic
986933225 5:12853223-12853245 TCATAAATATTCAGTATGTGGGG + Intergenic
987143367 5:14967350-14967372 CCATCAGTATGCAGCTTTTCCGG - Intergenic
987427041 5:17785623-17785645 TAATAAATATTCCTCTTTTTAGG + Intergenic
987442498 5:17973465-17973487 TAATAAATATTCACTATTTCAGG + Intergenic
987531279 5:19123574-19123596 TGATAAATATTAAGTTTTTGTGG + Intergenic
988620118 5:32814862-32814884 TCAGAAATATTCAGCTGTGTTGG - Intergenic
989273277 5:39556825-39556847 TCATACATATTCAGATTTCTTGG + Intergenic
989558957 5:42829263-42829285 TTATATAGATTCAGCTTTCCTGG - Intronic
990024528 5:51169242-51169264 TCATCAATTTATAGCTTTTCTGG + Intergenic
990033452 5:51290135-51290157 TCATAAATATGAAGTTTTTATGG - Intergenic
990588486 5:57237180-57237202 TCCTTATTATTCAGTTTTTCTGG + Intronic
991191541 5:63879887-63879909 TCTTTAATTTTCAGCTTTTCAGG - Intergenic
993009658 5:82465554-82465576 TCATTCATATTCCGCTTGTCTGG - Intergenic
993160119 5:84279486-84279508 TCATAAAGCTTCAGCTATTTTGG - Intronic
993478644 5:88396129-88396151 TCATAAATATCAAAATTTTCAGG + Intergenic
993693946 5:91037670-91037692 TCATAAATCTTCATTTCTTCTGG - Intronic
993830505 5:92752132-92752154 TTATAAATTTTAGGCTTTTCTGG - Intergenic
993852046 5:93022659-93022681 TCATAAGTCTTGAGATTTTCAGG + Intergenic
994030122 5:95132114-95132136 TCATAACTCTTCATCCTTTCAGG - Intronic
994139124 5:96322514-96322536 TCATTCTTATGCAGCTTTTCTGG + Intergenic
996124909 5:119713237-119713259 GCATATATTTTAAGCTTTTCAGG + Intergenic
996423149 5:123284590-123284612 TTAGAAATCTTCAACTTTTCTGG + Intergenic
998375463 5:141687651-141687673 AATTAAATATTCAGCTCTTCTGG - Intergenic
998569065 5:143240760-143240782 TATTAAATATTAAGCTTTTCTGG + Intergenic
999049608 5:148508187-148508209 TGATTAGTATTCAGCTGTTCTGG - Intronic
999183670 5:149689485-149689507 TCATAAATGTTCAGCTTGATGGG - Intergenic
999353202 5:150897539-150897561 TCAGGAAGATACAGCTTTTCTGG - Intronic
999463943 5:151783287-151783309 TCTGAAATCTTCATCTTTTCTGG - Intronic
999911061 5:156199854-156199876 TTTTAAATATACAGCTTCTCTGG - Intronic
1000948570 5:167452221-167452243 TTGTAAAGAGTCAGCTTTTCAGG - Intronic
1001678024 5:173534671-173534693 TCATACATTTGCAGCTTTTCAGG + Intergenic
1002830292 6:814482-814504 TTATAACTATTGAGCTTTTGAGG + Intergenic
1002924330 6:1596029-1596051 ACACACATCTTCAGCTTTTCTGG + Intergenic
1005469909 6:26153082-26153104 TGATAAATATTCAGATTCTGAGG + Intergenic
1006286346 6:33097298-33097320 AGATAAATATTCAGTTTCTCAGG - Intergenic
1008204038 6:48631253-48631275 TGATAAATATTCTGTGTTTCAGG - Intergenic
1009394779 6:63187098-63187120 TCATAAATATTAAGAATTACAGG - Intergenic
1009538348 6:64920893-64920915 TCATAAATCTTCAGCATGTCAGG + Intronic
1009629515 6:66176072-66176094 TCATAAATATTTATGTGTTCAGG + Intergenic
1009832838 6:68960833-68960855 TCATAAAAATGCAGATTCTCAGG - Intronic
1011653242 6:89526309-89526331 TCATGAATGTTCAACTTTTGTGG - Intronic
1013119260 6:107126765-107126787 ACATAAAAATTCAGATTTTGTGG - Intergenic
1013396216 6:109743347-109743369 TCATAAATGCTTAGGTTTTCAGG + Intronic
1014267250 6:119294088-119294110 TCATAAATACTCATCTTCTTTGG + Intronic
1014385912 6:120802210-120802232 ACATATATATTCTGTTTTTCTGG - Intergenic
1014865481 6:126524097-126524119 TAATTAATATTCAGCATTTAGGG - Intergenic
1015011741 6:128357553-128357575 TCTTAAGGATTCAGCATTTCTGG + Intronic
1015524413 6:134161913-134161935 TAACCAATATTAAGCTTTTCTGG - Intergenic
1016228020 6:141764762-141764784 AGATTAATAATCAGCTTTTCAGG - Intergenic
1016717081 6:147246552-147246574 ATATCAAGATTCAGCTTTTCTGG - Intronic
1016856133 6:148672369-148672391 TTATAAATATTCATTTCTTCTGG + Intergenic
1017290017 6:152725585-152725607 TCATAAATAGTTAGCTATTGTGG - Intergenic
1020744000 7:12057917-12057939 TCAGAACTATTCATCGTTTCAGG + Intergenic
1021434565 7:20599638-20599660 TCATTATTATTCAGATTTTGAGG - Intergenic
1022122509 7:27323240-27323262 TCACCAATATTCAGCCTCTCAGG + Intergenic
1023336986 7:39180717-39180739 TCAAAAATATCAAGCATTTCAGG - Intronic
1023344900 7:39261447-39261469 TGATGAAGAATCAGCTTTTCTGG + Intronic
1023961176 7:44927590-44927612 TCTAAAATATTCATCATTTCAGG - Intergenic
1024067257 7:45750675-45750697 TTTTAAATGTTCAGCCTTTCTGG + Intergenic
1024551935 7:50569760-50569782 TGAAAAAGACTCAGCTTTTCAGG + Intergenic
1026792393 7:73342701-73342723 TGATAAATTTTCAGTGTTTCTGG + Intronic
1027887403 7:83926998-83927020 TCATAATTATTTGGCTCTTCTGG + Intergenic
1027906405 7:84188793-84188815 TTAGAAATATTTAGTTTTTCAGG + Intronic
1027965629 7:85002285-85002307 TAATAAATTTTCAGCTTTCTAGG + Intronic
1028467267 7:91166924-91166946 TGAAAAATATTCCTCTTTTCTGG - Intronic
1028533655 7:91866436-91866458 TCTTAAATTTTCATCTTTTTGGG - Intronic
1028818317 7:95175881-95175903 TCTTAAATATTTATCTTTTTTGG + Intronic
1029009904 7:97248757-97248779 TCATTTATATTCAGTTTTTCTGG - Intergenic
1031851553 7:126870450-126870472 TCATTAAGCTTCATCTTTTCTGG + Intronic
1032214496 7:129947128-129947150 GCCTAAAAATTCAGCTTTTTGGG - Intronic
1032887719 7:136160172-136160194 TCAAAAATATTCCCCTTTTTAGG - Intergenic
1033499401 7:141932860-141932882 ACATACATTTTAAGCTTTTCAGG - Intronic
1033625276 7:143105101-143105123 TCATAAATATTCATAGTGTCAGG + Intergenic
1033967860 7:147000360-147000382 TCATACATCTCCATCTTTTCAGG + Intronic
1034784537 7:153913590-153913612 TGATAAATATTCAGTATTTGAGG + Intronic
1037698058 8:21245071-21245093 TCATAGATCTTCAGTTCTTCTGG + Intergenic
1038992327 8:32881248-32881270 TCTTAAATCTTCAGGTTTGCAGG - Intergenic
1040321054 8:46302993-46303015 TGTGAAATATTCAGTTTTTCAGG + Intergenic
1040392880 8:46964424-46964446 GGGTAAATATTCAGCCTTTCGGG - Intergenic
1043081997 8:75778199-75778221 TCATAAACCCTTAGCTTTTCAGG - Intergenic
1044387989 8:91612645-91612667 TCACAACTACTCAACTTTTCTGG + Intergenic
1045338669 8:101232367-101232389 CCATGAATATTAAGCCTTTCAGG - Intergenic
1045814331 8:106261775-106261797 TCATAGTTTTTCAGCATTTCAGG + Intergenic
1046183577 8:110684283-110684305 TGAGAAAAATTCAGCATTTCTGG - Intergenic
1046243122 8:111525653-111525675 TCATATATTTTCAGTTTTTGGGG + Intergenic
1046491901 8:114964590-114964612 TCATAAATATTCACCTCTTGGGG - Intergenic
1046557620 8:115794431-115794453 TTTTAAATTTTCAACTTTTCTGG - Intronic
1047466209 8:125117197-125117219 TCACCAATATTCAGCTTCTTTGG + Intronic
1047475251 8:125221987-125222009 TTATAAATATTCACCTTATTTGG + Intronic
1047928006 8:129700120-129700142 TCTTAAATAGTCAGCTCTTTGGG - Intergenic
1048513647 8:135085089-135085111 TAAAAAATATTCACCTTTTGGGG + Intergenic
1050008208 9:1157242-1157264 ACAAATATATTCAGCTTTTTGGG + Intergenic
1050170044 9:2805822-2805844 GGAAAATTATTCAGCTTTTCTGG - Intronic
1051468629 9:17408946-17408968 TTAGAAATATTAAACTTTTCTGG + Intronic
1052299000 9:26932556-26932578 AAATAAATTTTCTGCTTTTCAGG - Intronic
1052567716 9:30179025-30179047 TCATAAATAATCAGTTTTCCTGG - Intergenic
1052582339 9:30374039-30374061 TTATATTTATCCAGCTTTTCTGG - Intergenic
1053095658 9:35325959-35325981 ACATAAGTTTTCAGCTTTTTTGG + Intronic
1055037168 9:71830099-71830121 TAATTAATTTTCAGATTTTCAGG - Intergenic
1055901798 9:81247927-81247949 TTATAAAGTTTCAGCTTTGCAGG + Intergenic
1057044826 9:91877551-91877573 TCCTAAATATTCAGTATTTTGGG - Intronic
1058261763 9:102842050-102842072 ACATATATATTCATTTTTTCTGG + Intergenic
1058281815 9:103125748-103125770 TCTTGTATATTCAGCTTCTCAGG + Intergenic
1062226142 9:135452446-135452468 GCATACAAATACAGCTTTTCTGG - Intergenic
1203695069 Un_GL000214v1:90848-90870 TCAGAAATATTCCTCTTTGCTGG + Intergenic
1203466108 Un_GL000220v1:88963-88985 TGATAAAGATTCAACTTTACTGG + Intergenic
1203410917 Un_KI270579v1:1723-1745 TGATAAAGATTCAACTTTACTGG + Intergenic
1203410106 Un_KI270581v1:52-74 TGATAAAGATTCAACTTTACTGG - Intergenic
1203641204 Un_KI270751v1:13215-13237 TCAGAAATATTCCTCTTTGCTGG - Intergenic
1185994643 X:4931868-4931890 TCATAAATATTTAACCTTTCAGG - Intergenic
1186507548 X:10105067-10105089 TCATATATATTCAGATTTAAAGG + Intronic
1186631957 X:11359334-11359356 ACACAATTATTCAGATTTTCAGG + Intronic
1188168972 X:26897560-26897582 TTGTATATATTGAGCTTTTCTGG - Intergenic
1191744574 X:64472297-64472319 TCTACAATATACAGCTTTTCAGG + Intergenic
1192633909 X:72800787-72800809 CCATAGATCTTCAGTTTTTCTGG + Intronic
1192647801 X:72920014-72920036 CCATAGATCTTCAGTTTTTCTGG - Intronic
1193293047 X:79800446-79800468 TCATCAATATCCAGTTTTCCAGG + Intergenic
1194730169 X:97443611-97443633 TCATAAAAACTCAGCTTTAATGG - Intronic
1196049432 X:111289451-111289473 TGTTAAATATTCAGCTTCCCAGG + Intergenic
1196213010 X:113016531-113016553 TTATAAATATTCATATATTCAGG - Intergenic
1196324872 X:114390818-114390840 TCATAAATATTTGGCTTGTTAGG - Intergenic
1197083808 X:122449289-122449311 TCATTAATTTTCAGTTTATCAGG - Intergenic
1197359999 X:125489523-125489545 ACATAAATTTTCAAATTTTCTGG + Intergenic
1197923737 X:131624852-131624874 TTCTAAATATTCAGCTTCACTGG + Intergenic
1198833330 X:140775044-140775066 ACATAAATATACTGCTTTTCAGG - Intergenic
1201562910 Y:15336520-15336542 TAAGAAATATGCAGGTTTTCAGG + Intergenic