ID: 912175183

View in Genome Browser
Species Human (GRCh38)
Location 1:107146301-107146323
Sequence CTTTCCAAAGGGCCGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912175183 Original CRISPR CTTTCCAAAGGGCCGGGGGA TGG (reversed) Intronic
900490628 1:2947161-2947183 CTGTCCACAGGGCCGGGAGCGGG + Intergenic
900534288 1:3169392-3169414 CTCTCCTCAGGGCCGGGGGTTGG + Intronic
901057287 1:6454498-6454520 CTCGCCAAAGGGCCCGAGGATGG - Intronic
901516367 1:9749456-9749478 CTTACCACAGAGCCGGTGGAGGG + Exonic
902149246 1:14429502-14429524 CTTTCCAAAGGGCCGGGAAGTGG + Intergenic
902477071 1:16693972-16693994 CTCGCCAAAGGGCCAGAGGATGG + Intergenic
902809276 1:18879234-18879256 CTTTCATAATGGCCAGGGGAGGG + Intronic
903778067 1:25805850-25805872 CTGTCCAAAGGGCCTTGGGTTGG - Intronic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912527135 1:110291739-110291761 CTTTCCCCTGGGGCGGGGGAGGG + Intergenic
912708687 1:111934044-111934066 CCTCCCAAAGGCCCTGGGGAAGG + Intronic
914715360 1:150249942-150249964 ATTTCCAAGGGGCTGGGGGCAGG + Intergenic
915629856 1:157144624-157144646 CTTTCCTAAGTGCCAGGGGAAGG - Intergenic
920445450 1:206012682-206012704 GTTTCCTAGGAGCCGGGGGAGGG - Intronic
924686231 1:246293579-246293601 TTTTCCACTGTGCCGGGGGAGGG - Intronic
1063125103 10:3130069-3130091 CTTTCCAAGGGGCATGGAGATGG + Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1067295120 10:44971285-44971307 CTTTCCAAAGGCGCAGTGGAAGG - Intronic
1073061682 10:100737238-100737260 CTTTCCCGAGGTCCTGGGGAGGG - Intronic
1073190040 10:101644574-101644596 CTCTCCAGAGGGCCTGGGGCTGG + Intronic
1073348273 10:102800856-102800878 CTTTCCAAAGGAAGGTGGGAAGG - Intronic
1074189544 10:111123893-111123915 CTTTCCATAAGGCCAGGAGAAGG + Intergenic
1074501499 10:114028979-114029001 CATTGCAAGGGGCTGGGGGAAGG - Intergenic
1076192280 10:128491319-128491341 GTTTCCAAAGACCCGGAGGATGG + Intergenic
1079057857 11:17222712-17222734 ATTTCCAAATGGCAGTGGGATGG + Intronic
1081611435 11:44565535-44565557 CTTCCCAAAGGGCTCGGGGGCGG + Intronic
1082001283 11:47394928-47394950 TTTTGCAATGGGCCGGGGGTGGG - Intergenic
1083234486 11:61342879-61342901 CTTTGGAAAGGGCTGAGGGAGGG + Intronic
1083839687 11:65297156-65297178 CTTACCAAAGGGCAGGTGGGAGG + Exonic
1084333675 11:68444977-68444999 CTTCCTAAAGGGCAGGGGAAGGG + Intronic
1084502317 11:69542095-69542117 CTTTCCAAGAGGGCAGGGGATGG + Intergenic
1084572510 11:69968152-69968174 GTTCCCACAGGGCCAGGGGAAGG - Intergenic
1088830679 11:113533603-113533625 TTCTCCAAAGGGCAGAGGGATGG - Intergenic
1089678720 11:120107749-120107771 CTGTCCAGAGGGGCGGGGGCTGG - Intergenic
1090645681 11:128765037-128765059 GTGTGCACAGGGCCGGGGGAGGG + Intronic
1090660535 11:128878869-128878891 CTTGCCAAAGGGCCCCGGCATGG - Intergenic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1094528033 12:31245978-31246000 CATTCCAAAGGGCAGGCTGATGG - Intergenic
1098917203 12:76269851-76269873 TCTTCCAAAGTGCCTGGGGATGG + Intergenic
1101399778 12:104377297-104377319 CATTCCAGAGGGCAGGGTGAGGG + Intergenic
1101446684 12:104741999-104742021 GTTTCCCAAGTGCCGGGGGCAGG - Intronic
1104575626 12:129963600-129963622 CATTCCAAAGGGACGATGGAGGG + Intergenic
1106187108 13:27419252-27419274 CTTTCCACATGGCTGGGGGGTGG + Intergenic
1107833958 13:44398695-44398717 CTTTGCAAGGGGCTGGGGGCTGG - Intergenic
1107892368 13:44925299-44925321 ATTTCTAAAGGACCTGGGGAAGG - Intergenic
1107964594 13:45587696-45587718 CTTTCCAAAGGGCCTGAGGGCGG + Intronic
1107988869 13:45799608-45799630 CTTTCCCAAGGCCTGGGGGTTGG + Intronic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1108648125 13:52450459-52450481 CTTCCCAACGGGCTGGCGGAAGG - Intronic
1110918365 13:81052075-81052097 CTTTCCACAGGGTCAGGAGAGGG - Intergenic
1112943509 13:104895496-104895518 CTTTGCACAGGGCCGGGGGTAGG + Intergenic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113731141 13:112642319-112642341 CTTGCCCAAGGTCCAGGGGAAGG - Intergenic
1115891978 14:38040940-38040962 CTTTCCACAGGGCGGCAGGAAGG + Intronic
1117291080 14:54333549-54333571 ATTTCCTAAGGGCCGGGGGATGG - Intergenic
1118927150 14:70202355-70202377 CTTTCCAAAGGCTCTGGGGGAGG + Intergenic
1120169482 14:81234486-81234508 CTTGCCAAAGGGCTGGGGGGTGG + Intergenic
1120996601 14:90422628-90422650 CTCTCCAGAGGCACGGGGGACGG - Intergenic
1121409710 14:93741305-93741327 CTTTCCCAAGGGCCGGGGTTGGG + Intronic
1122875152 14:104660487-104660509 CTTTCCCAAGTGCAGGGGGGTGG - Intergenic
1124652153 15:31482305-31482327 CTTTCCAAAGGGAAGGGGCTGGG - Exonic
1126187204 15:45841800-45841822 CTTTCTAGAGGACCGGGGGTGGG + Intergenic
1128557367 15:68641045-68641067 CCTTTGAAAGGGCCAGGGGAAGG - Intronic
1130220882 15:82018493-82018515 CTTCCCCTAGGGCCAGGGGAAGG - Intergenic
1131513059 15:93060204-93060226 CTTACCAAGGGGCCGGAGGGTGG - Intronic
1131775734 15:95796345-95796367 CTTTTCAAAGGGTTGTGGGAAGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132370592 15:101295190-101295212 CTTTCCACAGCGCGGGGGAACGG - Exonic
1134440725 16:14298388-14298410 CTTTCCTTGGGGCCTGGGGAAGG - Intergenic
1135988625 16:27203421-27203443 CTGTTTAAAAGGCCGGGGGATGG - Intergenic
1139162736 16:64531479-64531501 CTTTCCAAAGGGATTGGAGATGG + Intergenic
1139209160 16:65059456-65059478 TTTTCCAAAGCGCCGATGGACGG + Intronic
1139282952 16:65785481-65785503 CTTTCCATGGGGCCTGAGGAAGG + Intergenic
1139466273 16:67155702-67155724 TTCTCCAAACGGCCGGAGGAGGG + Intronic
1139924018 16:70475806-70475828 CTTTCCCAAGGGCCCGCGGGGGG + Intronic
1141089551 16:81120968-81120990 CCTTCCAAAGAGCCAGGGTAGGG - Intergenic
1142401053 16:89858960-89858982 CTTTCCGGAAGGCCTGGGGAAGG + Intronic
1143263331 17:5616760-5616782 CTTCCCAAAGGGCTTAGGGAGGG - Intronic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1143895445 17:10132805-10132827 CTTTTAAAAAGGCTGGGGGAGGG + Intronic
1144484929 17:15656538-15656560 GTTTGCAAAGGGGCTGGGGAGGG - Intronic
1146052919 17:29567156-29567178 CTGTACAAAGGGCCGGGGCGGGG - Intronic
1148183961 17:45627873-45627895 TTTTCCACAGAGCCGGGGGCCGG + Intergenic
1151162385 17:72176334-72176356 CATTACACAAGGCCGGGGGAGGG - Intergenic
1151319903 17:73346789-73346811 CTCTCCAAAGACCTGGGGGAAGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152776985 17:82208164-82208186 CCTCCCAAAGGGCCGGGCGCAGG + Intronic
1153991113 18:10401664-10401686 CTTCCCAATGAGCCAGGGGAAGG - Intergenic
1160111329 18:76034522-76034544 CTGTTCAAAGGCCCTGGGGAAGG - Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161091018 19:2360145-2360167 CTTGGCAGGGGGCCGGGGGAGGG + Intergenic
1161216253 19:3096275-3096297 CTTTCCAGGGGGCCGCGGGTAGG + Intronic
1162142736 19:8594555-8594577 TTTTACAAAGGGGCAGGGGAGGG - Intronic
1162393580 19:10403906-10403928 GTTTACGAAGGGCAGGGGGAGGG - Intronic
1163332757 19:16651672-16651694 CTTTGCAAAGGTCCTGGGGCAGG - Intronic
1163332765 19:16651724-16651746 CTTTGCAAAGGTCCTGGGGCAGG - Intronic
1163332772 19:16651778-16651800 CTTTGCAAAGGTCCTGGGGCAGG - Intronic
1163332779 19:16651830-16651852 CTTTGCAAAGGTCCTGGGGCAGG - Intronic
1163332786 19:16651882-16651904 CTTTGCAAAGGTCCTGGGGCAGG - Intronic
1163332793 19:16651944-16651966 CTTTGCAAAGGTCCTGGGGCAGG - Intronic
1163332802 19:16651998-16652020 CTTTGCAAAGGTCCTGGGGAAGG - Intronic
1163686494 19:18714850-18714872 CCCTCCAAAGGGCTGAGGGAGGG - Intronic
1163695772 19:18762575-18762597 CTTTCCAGAGTGCAGGAGGAGGG + Intronic
1165096323 19:33411748-33411770 CACTGCAAAGAGCCGGGGGAGGG + Exonic
1166343967 19:42153977-42153999 CTGCCCAAGGTGCCGGGGGAGGG - Intronic
1167519561 19:49945847-49945869 CCTGTCAAGGGGCCGGGGGAGGG - Intronic
1168110414 19:54188995-54189017 GTTTCACAAGGGCCGGGGGATGG - Intronic
1202711087 1_KI270714v1_random:19798-19820 CTCGCCAAAGGGCCAGAGGATGG + Intergenic
925885565 2:8391479-8391501 CTTTCCAAAGGGCCAAGAAATGG + Intergenic
926701044 2:15803802-15803824 CTTTTGAGAGGGACGGGGGAGGG - Intergenic
929869894 2:45750289-45750311 TTTTCCCAGGGGCTGGGGGAGGG - Intronic
931891530 2:66678317-66678339 CTTTCCACAGGGTTGGGTGAAGG - Intergenic
932331308 2:70899994-70900016 CTTCCAGGAGGGCCGGGGGAGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935141787 2:100359600-100359622 CTTTCCAGAGGTCAGGAGGATGG + Intergenic
935593856 2:104864346-104864368 TTTGCCAAAGTGCGGGGGGAAGG - Intergenic
935868285 2:107416219-107416241 CTATCCAAAGGCCAGGAGGAAGG - Intergenic
938483294 2:131679765-131679787 CTTTCCCCAGGGCCATGGGATGG + Intergenic
938587143 2:132702242-132702264 CTTTCCAAAGTGACAGTGGACGG - Intronic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
948065931 2:235079990-235080012 GTTTGCCTAGGGCCGGGGGAGGG - Intergenic
948599626 2:239100881-239100903 CCTTCCAGAGGGACGGTGGAAGG + Intronic
1168910622 20:1443956-1443978 CTTTCCACAGGGCAGGGGTATGG - Intronic
1169355157 20:4899291-4899313 CTTGCCAAGGGGGCAGGGGAAGG + Intronic
1172066368 20:32223482-32223504 CTTTCCAAGAGGTCGGGGGGTGG + Intronic
1175939613 20:62531994-62532016 CTTTCCAAAGGGGCTAGGGCCGG + Intergenic
1176105681 20:63384729-63384751 GTTCCCACAGGGCCGGGAGAGGG + Intergenic
1176557708 21:8260570-8260592 CGTTCCGAAGGGACGGGCGATGG + Intergenic
1176568742 21:8399375-8399397 CGTTCCGAAGGGACGGGCGATGG + Intergenic
1176576656 21:8443610-8443632 CGTTCCGAAGGGACGGGCGATGG + Intergenic
1179792783 21:43764965-43764987 CCTGCCAAAGAGCTGGGGGAAGG + Intergenic
1180005976 21:45020853-45020875 CTTCCCGAAGGGTCGTGGGAGGG - Intergenic
1181328957 22:22074551-22074573 CTTTCCACAGGGACCAGGGAAGG - Intergenic
1182030976 22:27159209-27159231 ATTTGCAAAGGGCTTGGGGAGGG + Intergenic
1182137414 22:27919020-27919042 GCTTCGAAGGGGCCGGGGGAGGG + Intronic
1182278816 22:29206436-29206458 CTTTCCCAAGTGCAGGGGGAGGG - Intronic
1182560426 22:31154913-31154935 CTCTCCAGAGGGCAGAGGGAAGG - Intergenic
1182677520 22:32051198-32051220 CATTCCAAAGGGCAGGGAGTGGG + Intronic
1183502784 22:38190890-38190912 TTTTCCACGGAGCCGGGGGATGG + Intronic
1185424182 22:50755445-50755467 CTTTCCACAGCGCGGGGGAACGG - Intergenic
1203254706 22_KI270733v1_random:132667-132689 CGTTCCGAAGGGACGGGCGATGG + Intergenic
1203262762 22_KI270733v1_random:177746-177768 CGTTCCGAAGGGACGGGCGATGG + Intergenic
949569087 3:5274352-5274374 CTTTCCAGAGGCCCTAGGGATGG - Intergenic
950714698 3:14839432-14839454 CATTCCAAAGGGGGAGGGGAAGG - Intronic
953143477 3:40250850-40250872 CTGCCCAAAGGGCAGGGAGATGG + Intronic
953399625 3:42601139-42601161 CTCCCAAAAAGGCCGGGGGAGGG - Intronic
959808870 3:110592698-110592720 CAGAGCAAAGGGCCGGGGGATGG - Intergenic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
962519691 3:136186825-136186847 TTTTCCACAGGGTCAGGGGATGG - Intronic
967854640 3:194107386-194107408 CTTTCCACAGGGCGGCAGGAGGG - Intergenic
968432627 4:567710-567732 CTTTCCCAAGCCCCTGGGGAGGG + Intergenic
968855783 4:3120714-3120736 TTTTCCACAGGGCCAGGGGATGG - Intronic
969339630 4:6532029-6532051 CTTTGCAAAGGGCAGGAGGCTGG + Intronic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
976813391 4:89120692-89120714 AATTCCAAAGGGCGGGGGGTGGG - Intergenic
981220634 4:142229494-142229516 CTTTCCACATGGCCGGTGAATGG + Intronic
981812253 4:148789311-148789333 CCTTCCATAGGGCAGCGGGAGGG + Intergenic
985697128 5:1346924-1346946 CTCTCAACAGGGCAGGGGGACGG - Intergenic
990977322 5:61571373-61571395 ATTTCCCAAGGGCCTGGGGCAGG - Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
996379127 5:122845809-122845831 CCTTCCTCTGGGCCGGGGGAGGG - Intronic
996552821 5:124747807-124747829 CTTTCCCAAGGGGCCAGGGACGG + Intronic
998462717 5:142321438-142321460 CTTTCAAAAGAGCCAGGGGTAGG - Intronic
1001489444 5:172145247-172145269 CTTTCCTCAGGGCAGGGGCATGG - Intronic
1001861583 5:175060349-175060371 CTATCCAGTGGGGCGGGGGAGGG + Intergenic
1002934203 6:1657906-1657928 CTTTAAAAAGGGGAGGGGGATGG - Intronic
1003426785 6:6003206-6003228 CTTTCCAGCGGGGCGGGAGAGGG - Intronic
1005500777 6:26427263-26427285 ATATGCAAAGGGCCTGGGGAAGG + Intergenic
1005505344 6:26464583-26464605 ATATGCAAAGGGCCTGGGGAAGG + Intronic
1006411316 6:33875550-33875572 CTTCCCAGAGGGCCGAGGGCTGG + Intergenic
1007180427 6:39925748-39925770 CTTCACAAAGAGCCGGGCGAGGG + Exonic
1007745367 6:44040081-44040103 CGTGACACAGGGCCGGGGGAGGG - Intergenic
1011169354 6:84488942-84488964 ATTTCCAAGGGGCCAGGGGTGGG - Intergenic
1011947129 6:92919705-92919727 CTTTACAAAGGGCAAGTGGATGG + Intergenic
1013646485 6:112146602-112146624 CTTTCCTAAGGGCAGGGCCATGG + Intronic
1017549910 6:155495125-155495147 CTTTCCGGAGGACAGGGGGAAGG + Intergenic
1018846254 6:167558932-167558954 CCTCTCATAGGGCCGGGGGAAGG - Intergenic
1019760916 7:2811999-2812021 CTTTCCCAGGGGCAGTGGGAAGG + Intronic
1021904962 7:25324032-25324054 CATGCCAAAGGGCCTGGGGAAGG - Intergenic
1022105191 7:27192054-27192076 CTTTCCAACAGGGCTGGGGATGG + Intergenic
1023371896 7:39520030-39520052 CTTACCTGAGGGCCGGGGAAGGG - Intergenic
1024420394 7:49159222-49159244 CTCTCCAAAGGTTGGGGGGAAGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025202336 7:56970100-56970122 CTTCCCAAAAGCCCGGAGGATGG + Intergenic
1025669612 7:63606827-63606849 CTTCCCAAAAGCCCGGAGGATGG - Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1025781405 7:64605024-64605046 CTTTCCAGAGGGCAGGGGTGAGG - Intergenic
1028682404 7:93551629-93551651 TTTCCCAAAGGGTCAGGGGATGG - Intronic
1029424087 7:100485866-100485888 CTTGCCAAAGAGCCAGGGCAGGG + Intronic
1030185732 7:106759924-106759946 GTTTCCACAGGGGCGGGAGAAGG + Intergenic
1031757214 7:125660195-125660217 CTTTCCACAGTGCATGGGGAAGG - Intergenic
1034825166 7:154255593-154255615 CTTCCCACAGGGCAGGAGGAGGG - Intronic
1035062944 7:156082425-156082447 CTTTCCAAATGTCCCTGGGAGGG - Intergenic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1037828522 8:22174582-22174604 CTTCCCAAAGGGCAGGGGCAGGG + Intronic
1039395775 8:37223969-37223991 CTTTCCAAAGGGCCAAGGTGTGG + Intergenic
1040757117 8:50790089-50790111 CTACTCAAAGGGCCGTGGGAAGG - Intronic
1042348674 8:67753577-67753599 TTTTTCATAGGGCAGGGGGAAGG - Intergenic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1048945489 8:139443310-139443332 GTTTCCAACGGGGTGGGGGAGGG - Intergenic
1050073112 9:1837240-1837262 CTTTCCAAAGTGCCTGTGGTGGG + Intergenic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1051222160 9:14860262-14860284 CTTGCCAAAGGGGCTGGAGAAGG + Intronic
1055588426 9:77782972-77782994 GTTGCCAAATGGCAGGGGGAAGG + Intronic
1055646521 9:78366821-78366843 CTCTGCAGAGGGCAGGGGGAGGG + Intergenic
1059498748 9:114732162-114732184 GTTTCCAAGGGGCCGAGGGAAGG - Intergenic
1060991772 9:127853662-127853684 CTGCCCAAAGGCCCTGGGGAAGG + Intronic
1062298678 9:135850848-135850870 GTTTGTAAAGGGCAGGGGGAAGG + Intronic
1203471107 Un_GL000220v1:115812-115834 CGTTCCGAAGGGACGGGCGATGG + Intergenic
1203478928 Un_GL000220v1:159784-159806 CGTTCCGAAGGGACGGGCGATGG + Intergenic
1186068867 X:5795838-5795860 TTTTCCCATGGGCCAGGGGAGGG + Intergenic
1189287253 X:39860593-39860615 CTTTCCACAGGGGCTGGGGGAGG - Intergenic
1190464158 X:50709038-50709060 CCTTCCAGAGGGGTGGGGGACGG + Intronic
1195071379 X:101283953-101283975 GTTTTCAAAGGGCTGGGTGAGGG + Intronic
1199753589 X:150844223-150844245 CTTGCCAGAGGGCAGGGGAAAGG - Intronic