ID: 912175702

View in Genome Browser
Species Human (GRCh38)
Location 1:107153715-107153737
Sequence TGCACCCAAATTCAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 340}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912175702_912175708 29 Left 912175702 1:107153715-107153737 CCTGTTTTTTGAATTTGGGTGCA 0: 1
1: 0
2: 1
3: 41
4: 340
Right 912175708 1:107153767-107153789 GGACTCTATAGCATCTCCAGGGG No data
912175702_912175704 8 Left 912175702 1:107153715-107153737 CCTGTTTTTTGAATTTGGGTGCA 0: 1
1: 0
2: 1
3: 41
4: 340
Right 912175704 1:107153746-107153768 ATCGTCCACTACTTCTCATCAGG No data
912175702_912175707 28 Left 912175702 1:107153715-107153737 CCTGTTTTTTGAATTTGGGTGCA 0: 1
1: 0
2: 1
3: 41
4: 340
Right 912175707 1:107153766-107153788 AGGACTCTATAGCATCTCCAGGG No data
912175702_912175706 27 Left 912175702 1:107153715-107153737 CCTGTTTTTTGAATTTGGGTGCA 0: 1
1: 0
2: 1
3: 41
4: 340
Right 912175706 1:107153765-107153787 CAGGACTCTATAGCATCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912175702 Original CRISPR TGCACCCAAATTCAAAAAAC AGG (reversed) Intronic
903197008 1:21697700-21697722 TGAACCCAAATTCTACAATCAGG + Intronic
904192654 1:28759173-28759195 TACACCCAAATTTAAAATACAGG - Intronic
906598577 1:47104083-47104105 TGAAAGCAAATTCAAAAAATTGG - Intronic
909024975 1:70470943-70470965 AGCACCCATATTCAAAAAGCAGG + Intergenic
909176459 1:72367864-72367886 TGCACACAAATTAGAAAACCTGG - Intergenic
909414463 1:75389164-75389186 AGCACTCAGATTCATAAAACAGG + Intronic
910190592 1:84591079-84591101 AGCACCCAGATTCATAAAGCAGG + Intergenic
910305319 1:85756081-85756103 GGCAACCCAATTCAAAAAATGGG + Intronic
910801502 1:91151984-91152006 TGCATCCAAAAGCAAAAAATGGG + Intergenic
911725978 1:101240796-101240818 TTCAACCAAATTCCAAAAAACGG - Exonic
911744711 1:101428010-101428032 AGCACCCAGATTCATAAAGCAGG - Intergenic
911876228 1:103166673-103166695 AGCACCAAGATTCATAAAACAGG - Intergenic
912010224 1:104950442-104950464 TACATCCAAATTCATAAAAGTGG + Intergenic
912175702 1:107153715-107153737 TGCACCCAAATTCAAAAAACAGG - Intronic
912935443 1:114000169-114000191 TGCACCCAAAAAGAAGAAACTGG + Intergenic
917308573 1:173653758-173653780 AGCACCCAGATTCATAAAGCAGG - Intronic
917324132 1:173814164-173814186 AGCACCCAGATTCATAAAGCAGG + Intronic
917813862 1:178687642-178687664 TGCACCAATATTCAAAAAGCAGG + Intergenic
919444802 1:197689665-197689687 AGCACCCATATTAAGAAAACTGG + Intronic
921440436 1:215180016-215180038 ACCACCCAGATTCATAAAACAGG - Intronic
921858856 1:220019230-220019252 TGAGCCCAAATTCAAGGAACAGG + Intronic
922114896 1:222603297-222603319 TCCCCCCAAATTTAAAAAGCTGG - Intergenic
924273349 1:242358502-242358524 TCCACCCAAATTCAGAGAAAAGG - Intronic
924653377 1:245949930-245949952 TGAATGCAAATTTAAAAAACTGG + Intronic
1064049180 10:12045112-12045134 ATCACCTAAAATCAAAAAACAGG + Intergenic
1064609425 10:17082388-17082410 TGCACAAAAAATCATAAAACTGG - Intronic
1064687197 10:17875033-17875055 TGCAGACAAATTCAAGAATCTGG - Intronic
1066176690 10:32914646-32914668 AGCACCCAGATTCATAAAGCAGG + Intronic
1066695262 10:38071724-38071746 TGCATGCAAATTCAAAATATAGG + Intergenic
1067237727 10:44465721-44465743 TGGACCCAAATACAAAACACAGG - Intergenic
1067841505 10:49683351-49683373 TGCAACCCAATTTAAAAAATGGG - Intronic
1070478897 10:76860820-76860842 TTCACCCAAAATTTAAAAACAGG - Intergenic
1071471200 10:85985144-85985166 TGCACCCAAATTAGAACCACTGG + Intronic
1072373618 10:94792023-94792045 AGCACCCAGATTCATAAAACAGG - Intronic
1072374280 10:94798649-94798671 AGCACCCAGATTCATAAAGCAGG - Intronic
1073565457 10:104531997-104532019 AGCACCCAGATTCATAAAGCAGG - Intergenic
1075395457 10:122123742-122123764 TGCACCCCACTTCAGAACACCGG - Intronic
1076677119 10:132152934-132152956 TGCACCCAAAAGCAGAACACAGG - Intronic
1077668027 11:4132504-4132526 TGCACCCAAACTAAGAAAATGGG - Intronic
1078161398 11:8842931-8842953 TGTAAGCAAATTCAAAAATCAGG + Intronic
1079342324 11:19622416-19622438 AGCACCCAGATTCATAAAGCAGG - Intronic
1079755925 11:24262074-24262096 TGCTCACAAATTCACAAATCTGG + Intergenic
1080286370 11:30618760-30618782 TTCACCAAAATGAAAAAAACTGG - Intergenic
1080981887 11:37417470-37417492 TGCACCCAAAATCTAATATCTGG + Intergenic
1081425131 11:42918041-42918063 AGCACCCAGATGCATAAAACAGG + Intergenic
1082880335 11:58030954-58030976 TGCAACCATATACCAAAAACTGG + Exonic
1083522046 11:63322916-63322938 AGCACCCAGATTCATAAAGCAGG + Intronic
1083772568 11:64876715-64876737 GGCTTCCAAATTCAGAAAACTGG + Intronic
1084842572 11:71867945-71867967 TGTGCGCAAATTCATAAAACAGG - Intronic
1084906660 11:72353675-72353697 TGGACCCAAATCCAGAGAACAGG + Intronic
1086478719 11:87209530-87209552 AGTACCCAGATTCATAAAACAGG + Intronic
1086599337 11:88613357-88613379 AGCACCCAGATTCATAAAACAGG - Intronic
1086653062 11:89316915-89316937 AGCACCCAGATTCATAAAGCAGG - Intergenic
1087907768 11:103719272-103719294 AGCACCAAGATTCATAAAACAGG - Intergenic
1087910428 11:103746739-103746761 TGCACACAAATTAGAAAATCTGG - Intergenic
1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG + Intergenic
1091850687 12:3694395-3694417 TACACACAAATTCAGAAAGCAGG - Intronic
1092120849 12:6042743-6042765 TGACCCCAAATCCAAAAAAGAGG - Intronic
1094054880 12:26258627-26258649 AGCACCCAGATTCATAAAACAGG + Intronic
1095918065 12:47500048-47500070 AGCACCCAGATTCATAAAGCTGG + Intergenic
1096359878 12:50974971-50974993 AGCACCCAGATTCATAAAGCAGG + Intergenic
1096424034 12:51485645-51485667 TGCAAGCAAATTTAAACAACAGG - Intronic
1097305641 12:58066288-58066310 TGCTCCAAAATTCTAAAGACAGG - Intergenic
1097661662 12:62436689-62436711 TAAAAGCAAATTCAAAAAACTGG + Intergenic
1097917248 12:65034113-65034135 AGCACCCAGATTCATAAAGCAGG - Intergenic
1098347628 12:69523240-69523262 AGCACCCAGATTCATAAAGCAGG - Intronic
1099241797 12:80147715-80147737 AGCACCCAGATTCATAAAGCAGG - Intergenic
1099767358 12:87004742-87004764 TGCACACAAATTAGAAAAACTGG - Intergenic
1101028836 12:100640483-100640505 GGCACCCAGATTCATAAAGCAGG - Intergenic
1101277062 12:103214525-103214547 GGCATCCTAATTCAAAAGACGGG + Intergenic
1102437075 12:112932765-112932787 TGCTCCCAAAGTCACACAACTGG + Intergenic
1107106727 13:36651426-36651448 TGCACTCAAAGTCAAGAAATTGG - Intergenic
1109631481 13:65054740-65054762 AGCACCTAGATTCATAAAACAGG + Intergenic
1110399202 13:75070053-75070075 TGGACCCAATTTCTAAAAAGCGG - Intergenic
1110615101 13:77532819-77532841 TGAACCTAAACTCAAAAAAACGG + Intergenic
1110909547 13:80939521-80939543 TGAAAGCAAATTCAAAAAATTGG - Intergenic
1112964609 13:105172616-105172638 TGGAACCAAATTGAGAAAACTGG + Intergenic
1114127887 14:19751654-19751676 TGCACACAAATTAGAAAATCTGG - Intronic
1114888532 14:26886651-26886673 TGCCACCAAATTGAAAAAAGGGG - Intergenic
1115124456 14:29974819-29974841 AGCACCCAGATTCATAAAGCAGG + Intronic
1115856014 14:37630740-37630762 AGCACCCAGATTCATAAAGCAGG - Intronic
1116074163 14:40088799-40088821 AGCACCCAGATTCATAAAACAGG - Intergenic
1116109126 14:40553071-40553093 AGCACCAAGATTCATAAAACAGG + Intergenic
1116471437 14:45290197-45290219 TGAACCCAAAATGACAAAACGGG + Intergenic
1116576678 14:46584020-46584042 TGCACCTAATTTGGAAAAACTGG - Intergenic
1116634671 14:47379703-47379725 AGCACCCAGATTCATAAAGCAGG + Intronic
1117785996 14:59285755-59285777 AGCACCCAGATTCATAAAACAGG + Intronic
1117821696 14:59657106-59657128 TGCACAAAAAGTCACAAAACAGG + Intronic
1117966658 14:61213452-61213474 TGGACCCAAATGCAAAGAACTGG + Intronic
1118490393 14:66253638-66253660 TTCACCCAACATCACAAAACTGG + Intergenic
1119041883 14:71281954-71281976 GGGACCCAAATACAGAAAACTGG + Intergenic
1120355302 14:83426003-83426025 TGGAGCCCAAATCAAAAAACAGG - Intergenic
1121853002 14:97240000-97240022 TGCAGCCAAATTCGAGAATCAGG - Intergenic
1123571340 15:21613104-21613126 TGCACACAAATTAGAAAATCTGG - Intergenic
1123607454 15:22048455-22048477 TGCACACAAATTAGAAAATCTGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124952910 15:34339805-34339827 TGCAGCCAACATTAAAAAACTGG + Intergenic
1126459451 15:48899655-48899677 TGCACACACATTTAAAAAAATGG - Intronic
1130174765 15:81557031-81557053 AGCACACCAATTCATAAAACAGG - Intergenic
1131722104 15:95180814-95180836 TGCAAAAAAATTCAAAAAACTGG + Intergenic
1202979693 15_KI270727v1_random:340231-340253 TGCACACAAATTAGAAAATCTGG - Intergenic
1133493043 16:6290139-6290161 TGCAGCAAAATTCATAAAAAAGG - Intronic
1133493069 16:6290438-6290460 TGCAGCAAAATTCATAAAAAAGG - Intronic
1135121775 16:19772374-19772396 TGGATCCCAATTCAAAAAAACGG + Intronic
1136269101 16:29138106-29138128 TTCACCTCAATTTAAAAAACAGG + Intergenic
1136715063 16:32273096-32273118 TGCACGCAAATTAGAAAATCTGG + Intergenic
1136752852 16:32656635-32656657 TGCACGCAAATTAGAAAATCTGG - Intergenic
1136815262 16:33213730-33213752 TGCACGCAAATTAGAAAATCTGG + Intronic
1136821738 16:33323810-33323832 TGCACGCAAATTAGAAAATCTGG + Intergenic
1136828301 16:33380349-33380371 TGCACGCAAATTAGAAAATCTGG + Intergenic
1136833367 16:33479121-33479143 TGCACGCAAATTAGAAAATCTGG + Intergenic
1139129305 16:64121527-64121549 AGCTCCCTAATTCATAAAACTGG + Intergenic
1139214120 16:65110683-65110705 TGAATCCAAATTTAAAACACAGG + Intronic
1139247413 16:65459308-65459330 TGCACCCACTTTGAAAAACCGGG - Intergenic
1140143691 16:72285150-72285172 TGCAACCAAACTCATAGAACCGG + Intergenic
1140382329 16:74501208-74501230 TACAGCCAAATTTAAAAAAGAGG - Intronic
1141123685 16:81384541-81384563 AGCACCCAAATCCCAAATACTGG - Exonic
1142072584 16:88099378-88099400 TTCACCTCAATTTAAAAAACAGG + Intronic
1202993839 16_KI270728v1_random:36705-36727 TGCACGCAAATTAGAAAATCTGG + Intergenic
1203011549 16_KI270728v1_random:245400-245422 TGCACGCAAATTAGAAAATCTGG - Intergenic
1203054989 16_KI270728v1_random:916673-916695 TGCACGCAAATTAGAAAATCTGG - Intergenic
1143288461 17:5810080-5810102 CGCACCCAAACTCAATACACAGG + Intronic
1144364895 17:14533776-14533798 AGCACCCAGATTCATAAAGCAGG - Intergenic
1145884981 17:28375628-28375650 TGCACATAAATTCAAAAAAGTGG + Intronic
1146173699 17:30651360-30651382 TGCACGCAACTTCTAGAAACGGG - Intergenic
1146325749 17:31884501-31884523 TGCACCTAAATTTAAAAAGCAGG + Exonic
1146614311 17:34340940-34340962 AGCACTAAAATTCATAAAACAGG - Intergenic
1149055156 17:52354885-52354907 AGCACCCAGATTCATAAAGCAGG - Intergenic
1149886280 17:60343133-60343155 AGCACCCAGATTCATAAAGCAGG + Intronic
1153119326 18:1702136-1702158 AGCACCCAGATTCATAAGACAGG + Intergenic
1155540258 18:26862636-26862658 TTCACCTAAATTCATAAACCTGG - Intronic
1155967215 18:32047348-32047370 TGAACTCAAATTCTAAAAACTGG - Intronic
1156319029 18:36000777-36000799 TTCACCCAAAGTCAACAGACAGG + Intronic
1156927033 18:42594822-42594844 AGTACCCAGATTCACAAAACTGG - Intergenic
1157321429 18:46637556-46637578 TTCACCCCAGTTGAAAAAACAGG + Intronic
1159181453 18:64911835-64911857 TGCACCAAAATATAAAAAAAAGG - Intergenic
1164798122 19:31052823-31052845 TCCAACCATAGTCAAAAAACAGG + Intergenic
1165315477 19:35052830-35052852 TGCACCCAAAGCCAAAACACTGG + Intronic
1166256048 19:41605557-41605579 TGAACCCAAAATGACAAAACGGG - Intronic
1166260690 19:41638720-41638742 TGAACCCAAAATGACAAAACAGG - Intronic
1167391703 19:49199564-49199586 TGAACCCCAATTAAAAAAACGGG - Intronic
925314799 2:2913110-2913132 TGCAGGCAAATACAAAAAACAGG - Intergenic
925318548 2:2943342-2943364 TGCACCCATATTGCAAGAACAGG + Intergenic
925464403 2:4093886-4093908 TGAACTCAAATTCAACACACTGG - Intergenic
927034058 2:19154295-19154317 AGAACTAAAATTCAAAAAACTGG + Intergenic
927125159 2:20006884-20006906 AGCCCCCAAATTCACTAAACAGG - Intronic
927393056 2:22617867-22617889 GGCACCCAAAGTCACAAAGCAGG - Intergenic
928818034 2:35323416-35323438 AGCACCCAGATTCATAAAGCAGG - Intergenic
929875500 2:45793223-45793245 TTCGCCCAAATTCAACAAATAGG - Intronic
933085194 2:78046591-78046613 TGCTCCCAAATGGAAGAAACTGG - Intergenic
933533464 2:83539926-83539948 TGCAGCCAGATGCAAAAAAATGG - Intergenic
935384886 2:102489564-102489586 TGCACCCTAGGTCAATAAACAGG + Intronic
936141143 2:109942111-109942133 TGCACACAAATTAGAAAATCTGG + Intergenic
936177831 2:110240056-110240078 TGCACACAAATTAGAAAATCTGG + Intergenic
936203550 2:110429375-110429397 TGCACACAAATTAGAAAATCTGG - Intronic
936561094 2:113540767-113540789 CGCACCCAAACTCCAAAACCAGG - Intergenic
938157141 2:128951499-128951521 TGCAGCCAAATTGGCAAAACAGG + Intergenic
939232886 2:139453976-139453998 TGAAAGCAAATTCAAAAAACTGG - Intergenic
939546480 2:143560888-143560910 TGTCACCAAATTCAACAAACAGG - Intronic
940557974 2:155256673-155256695 TGAAACCAAATTCAAAAGATTGG - Intergenic
940739576 2:157492159-157492181 TGCACCCAAATTTACTGAACAGG + Intergenic
940959220 2:159764393-159764415 TGCTCCCAATTTTAAAAAACTGG + Intronic
941268089 2:163389038-163389060 TCAACCTAAATTCATAAAACTGG + Intergenic
941733548 2:168946798-168946820 TGCACCAGAAGCCAAAAAACAGG - Intronic
942854585 2:180530373-180530395 AGCACCCAGATTCATAAAGCAGG - Intergenic
943126036 2:183793893-183793915 AGCACCCAGATTCATAAAGCAGG + Intergenic
944190539 2:196998722-196998744 TCCACCAAGAATCAAAAAACAGG + Intronic
944268150 2:197750628-197750650 AGCACCCAGATTCACAAAGCAGG + Intronic
944275375 2:197831501-197831523 AGCACCCAGATTCATAAAGCAGG + Intronic
944607568 2:201366096-201366118 AGCAACCAGATTCATAAAACAGG + Intergenic
945024043 2:205603510-205603532 AGCACCCAGATTCATAAAACAGG - Intronic
946407469 2:219499222-219499244 TGAACCCCAAATCAAAAGACAGG - Exonic
947465792 2:230344180-230344202 AGCACCCAGATTCATAAAGCAGG - Intronic
1169500397 20:6154647-6154669 TGCACACAAATTAGAAAATCTGG - Intergenic
1169551914 20:6709760-6709782 TGCACACAAATACACAACACAGG - Intergenic
1169977938 20:11351882-11351904 TGCACCCACATGAAAAAAGCTGG + Intergenic
1171060633 20:21956253-21956275 TGAAAGCAAATTCAATAAACTGG - Intergenic
1175741773 20:61424931-61424953 CGGAGCCAAATTTAAAAAACTGG + Intronic
1175784643 20:61704902-61704924 TGCACCCAGATTCCAGAACCAGG + Intronic
1176749423 21:10679119-10679141 TGCACTCGAATTCAATAAAATGG - Intergenic
1178048226 21:28720019-28720041 AGCACACAAATGTAAAAAACAGG - Intergenic
1178104412 21:29301605-29301627 TGTCTCCAAATTCAAAATACAGG - Intronic
1178120492 21:29465150-29465172 TGCAGCCAAATTAAATACACTGG + Intronic
1178667229 21:34559017-34559039 TCCACCTAAATGCTAAAAACAGG + Intronic
1179157402 21:38862530-38862552 TGCACCAAAAAACAGAAAACTGG + Intergenic
1182098297 22:27640389-27640411 TGAAGCTAAATTCAAAAACCAGG - Intergenic
1183922413 22:41179483-41179505 TGCACCCAGAGAAAAAAAACTGG - Exonic
949698792 3:6731285-6731307 TGTACACACATTAAAAAAACAGG - Intergenic
949800966 3:7903987-7904009 AGCACCCAGATTCATAAAGCAGG - Intergenic
950717491 3:14860042-14860064 TGAACAGAAATTCAAAACACAGG + Intronic
950792449 3:15483873-15483895 AGCACCCAGATTCATAAAGCAGG - Intronic
951084314 3:18492924-18492946 AGCACCCCAATACAACAAACTGG + Intergenic
951285505 3:20808000-20808022 TTCACACAAAGTTAAAAAACAGG - Intergenic
951970301 3:28437085-28437107 TGCTCCCAACTTCAGAAAAAAGG + Intronic
951985949 3:28621067-28621089 AGCACCCACATTCATAAAGCAGG + Intergenic
952669693 3:35951585-35951607 AGCACTCAGATTCATAAAACAGG - Intergenic
952777806 3:37063003-37063025 TGCACCAAGATTCAACAAACTGG + Intronic
953689292 3:45104204-45104226 TGCCCCCAGAATCAATAAACTGG - Intronic
955175802 3:56612174-56612196 TGAAAGCAAATTCAAAAAATCGG - Intronic
956326910 3:68063042-68063064 TGTATCCAGATTAAAAAAACAGG + Intronic
957760173 3:84545538-84545560 TGCACACAAATTAGAAAATCTGG - Intergenic
958057891 3:88436871-88436893 TGCCCCCAAATTTTAAATACTGG - Intergenic
958058740 3:88449595-88449617 TGCACCACAATCCAAATAACAGG - Intergenic
958119017 3:89260629-89260651 TGCAACCAAATGCAAACAAAGGG - Intronic
958197605 3:90261920-90261942 TGAACCCAAATTAAAACTACAGG + Intergenic
958421053 3:93932024-93932046 TGAACCCAAATTAAAACTACAGG + Intronic
958497264 3:94861231-94861253 AGCACACAGATTCAGAAAACAGG - Intergenic
958687758 3:97422436-97422458 AGTACCCAGATTCATAAAACAGG + Intronic
958961941 3:100519088-100519110 TCCACCCAACTTCAGAAACCTGG - Intronic
960634868 3:119774809-119774831 TTCCCCCCAATTTAAAAAACTGG - Intergenic
961143073 3:124571984-124572006 TGCACCCCAAATTAAAAAATTGG - Intronic
962001420 3:131302121-131302143 TGCACACAAACTGAAAAACCTGG - Intronic
962190000 3:133300388-133300410 TGCCGCCAAAGTAAAAAAACAGG - Intronic
962556091 3:136553257-136553279 TGCACAGAAATTCAAAAATATGG + Intronic
966205520 3:177402313-177402335 TGCATCCAAACTCATCAAACAGG - Intergenic
966327502 3:178773426-178773448 TGGACCCAGATTCAAAAAGGGGG - Intronic
966531528 3:180986968-180986990 TGAACCCAAAATGACAAAACGGG - Exonic
967360702 3:188627627-188627649 AGCACCCAGATTTATAAAACAGG + Intronic
967622015 3:191644725-191644747 AGCACCCACACTCATAAAACAGG + Intergenic
967871853 3:194236402-194236424 TGCTCCCAAATTGAAGAGACAGG + Intergenic
968080665 3:195844289-195844311 TGCAGCTAAATTCGAGAAACAGG + Intergenic
968539920 4:1162157-1162179 AACACCCAAATTCAAATAACTGG - Intergenic
969553406 4:7888486-7888508 TGCCCACAAATTCAAAAACATGG + Intronic
970383812 4:15536152-15536174 TCCATCCAAAGTCAAAAAAGTGG + Intronic
970502161 4:16689221-16689243 AGCACCCAAATCCACAACACAGG + Intronic
971513382 4:27455936-27455958 TGTACCCAAGCTCAAAAATCTGG + Intergenic
972226184 4:37015512-37015534 TGCATCTAGATTCAAAAAATAGG + Intergenic
972481900 4:39504664-39504686 GGCAATCAGATTCAAAAAACAGG - Intronic
973063468 4:45759421-45759443 TTCACACAAATTCACAAAACAGG + Intergenic
974476286 4:62386172-62386194 TGTAACAAAATTCAATAAACTGG - Intergenic
975041155 4:69745362-69745384 AGCATCTAAATTCATAAAACTGG - Intronic
975902573 4:79170038-79170060 CCCACCCAAATTCAAAAGAAAGG - Intergenic
976111672 4:81681686-81681708 TGTACCTAAAGTAAAAAAACAGG + Intronic
977946707 4:102921892-102921914 AGCACCCAGATTCATAAAGCAGG + Intronic
979618436 4:122770997-122771019 AGCCCCCAAATTAAACAAACCGG + Intergenic
980053538 4:128060548-128060570 TTTACCCAAATTAAAGAAACAGG + Intergenic
980803784 4:137786130-137786152 AGCACCCAGATTCATAAAGCAGG + Intergenic
980865089 4:138544692-138544714 AGCACCCAGATTCCTAAAACAGG + Intergenic
981142893 4:141291337-141291359 TGAAAGCAAATTCAAAAACCTGG - Intergenic
982903681 4:161041240-161041262 TGCACCAACATTGATAAAACTGG + Intergenic
983586240 4:169358139-169358161 AGCATCCAAATTCAAAAGTCAGG + Intergenic
983858616 4:172676525-172676547 TGCACCCAAGCCCAAAATACAGG - Intronic
984625849 4:182007383-182007405 AGCACCCAGATTCATAAAACAGG - Intergenic
984628272 4:182033695-182033717 AGCACCCAGCTTCATAAAACAGG - Intergenic
987195047 5:15517806-15517828 TTCTCCCAAATTCACAAATCAGG - Intronic
987739937 5:21894678-21894700 TGCAACTAAATTCAAAAAAGGGG - Intronic
988443860 5:31262957-31262979 TGCCCCTAAATGCAAAAAACAGG - Intronic
989676466 5:43979532-43979554 AGCACCGAGATTCATAAAACAGG - Intergenic
990400323 5:55430600-55430622 TGAAGGCAAATTCAAAAAATTGG + Intronic
991606634 5:68408695-68408717 AGGACTCATATTCAAAAAACAGG - Intergenic
991627828 5:68622659-68622681 TGCACACAATTTCAATAAATGGG + Intergenic
991668984 5:69028283-69028305 TCCACCAAACTTCAAGAAACAGG + Intergenic
992118163 5:73562753-73562775 TGGACCCAAATTCAGAAGAAGGG - Exonic
992124976 5:73630667-73630689 TTCACCCAAGGTCACAAAACTGG - Intronic
992153738 5:73933149-73933171 TGAACTCAAATTTAAAAGACTGG + Intronic
993783367 5:92097628-92097650 TGCACCCCTATGCAAAAAAGTGG - Intergenic
994603703 5:101940792-101940814 AGCACCCAGATTCATAAAATGGG - Intergenic
994701898 5:103143964-103143986 GGCATCCAAATTGAAAAAAAAGG + Intronic
995304817 5:110632257-110632279 TGAAAGCAAATTCAAAAAATTGG + Intronic
995840419 5:116438543-116438565 GGCACCCAAATTCAAGAAGATGG + Intergenic
995934720 5:117496058-117496080 TTCACCCATATTGGAAAAACAGG - Intergenic
996426364 5:123317934-123317956 AGCACCCAGATTCTTAAAACAGG - Intergenic
996486402 5:124040589-124040611 AACTCCCAAATTCATAAAACTGG + Intergenic
997450159 5:133976159-133976181 TTCACCAAATTTCACAAAACAGG + Intronic
997802879 5:136884399-136884421 TGCACAAAAATGCAAAAAAATGG - Intergenic
998913564 5:146989775-146989797 GGCACCCAAATTTTAAAAAGTGG + Intronic
1000134590 5:158335022-158335044 GACACCCAGATTCATAAAACAGG - Intergenic
1000531227 5:162422814-162422836 TGAGCCCAAAGTCAAAAAGCAGG + Intergenic
1003072914 6:2958677-2958699 TCCACCCAGATTCAACAACCAGG + Intronic
1003250407 6:4424762-4424784 TCCTCCCAAAATCAGAAAACAGG + Intergenic
1004086293 6:12452800-12452822 TGGACCCTTATTCAAAAAACTGG - Intergenic
1008259928 6:49352953-49352975 TGCACACAAATTAGAAAACCTGG + Intergenic
1009729821 6:67586597-67586619 AGCACACAGATTCATAAAACAGG - Intergenic
1009775403 6:68199173-68199195 TGCACACAAATTAGAAAATCTGG + Intergenic
1011415167 6:87111177-87111199 TACACACAAATTTAAAAAATAGG - Intergenic
1012571938 6:100740592-100740614 AGCACCCAGATTCATAAAGCAGG - Intronic
1012614786 6:101263388-101263410 AGCCCCAAAATGCAAAAAACAGG - Intergenic
1013922875 6:115430472-115430494 TGCACCCAAATTAACTTAACTGG - Intergenic
1014479748 6:121921308-121921330 GGCACACTAATTCAAAATACTGG + Intergenic
1014536412 6:122619077-122619099 TGCAAACAGATTGAAAAAACAGG - Intronic
1015365679 6:132394324-132394346 TGAAAGCAAATTCAAAAAACTGG + Intronic
1015388802 6:132656692-132656714 AGCACCCAAATAGAAAGAACTGG + Intergenic
1016142740 6:140632643-140632665 TACACACACATTCAAAAAATTGG - Intergenic
1017147263 6:151245984-151246006 TGCACCCAAATTAATAAGAATGG - Intronic
1017396543 6:154006700-154006722 TTCAAAAAAATTCAAAAAACTGG + Intergenic
1017703794 6:157101072-157101094 TGCATCCAAAATTAAAACACTGG - Intronic
1017970495 6:159308330-159308352 TGCACAGAAGTTCCAAAAACAGG - Intergenic
1018307560 6:162473669-162473691 TACACCCAATTTCAAAAACTTGG - Intronic
1018353011 6:162982057-162982079 TGCACACAAATTAGAAAATCTGG - Intronic
1019068495 6:169322607-169322629 TGAGCCCAAATTCTAAAGACAGG + Intergenic
1019865567 7:3706824-3706846 TGCACACAAATTAGAAAATCTGG - Intronic
1020672286 7:11131477-11131499 TACAACCCAATTTAAAAAACAGG - Intronic
1022064173 7:26833703-26833725 AGCACCCAGATTCATAAAGCAGG + Intronic
1023704242 7:42923965-42923987 TACACCCAAACTTAAGAAACTGG + Intronic
1027938221 7:84636762-84636784 TGAAAGCAAATTCAAAAAACTGG - Intergenic
1028287456 7:89021089-89021111 TGAACCCAACTCCATAAAACTGG - Intronic
1028337504 7:89675361-89675383 AGCACCCAGATTCATAAAGCAGG + Intergenic
1028369285 7:90072433-90072455 AGCACCCAGATTCACAAAACAGG + Intergenic
1028963815 7:96779357-96779379 TATTCACAAATTCAAAAAACTGG + Intergenic
1029931736 7:104379030-104379052 TGCTCCCAAATTCTGAAATCGGG + Intronic
1030224283 7:107131620-107131642 TGAGCTCAAATTCAAAAAAAAGG - Intronic
1030358701 7:108570841-108570863 TGGTCCCGTATTCAAAAAACAGG + Intronic
1030813182 7:114001795-114001817 AGCACCCAGATTCATAAAGCAGG + Intronic
1031131920 7:117842687-117842709 TTCACCTAAAATCAAAAAATGGG + Intronic
1031303868 7:120099178-120099200 TGCACCCAAATTCTAAATCTTGG - Intergenic
1032965923 7:137097410-137097432 TGCATCCAAATTTTAAAAAGAGG + Intergenic
1033991768 7:147296685-147296707 TGCACCCATATTCATATATCAGG - Intronic
1035632031 8:1115346-1115368 AGCACCCAGATTCATAAAGCAGG - Intergenic
1036188926 8:6651783-6651805 GGCACCCAGATTCATAAAGCAGG + Intergenic
1039030395 8:33302832-33302854 AGCAGCCAAATACAAAAACCAGG + Intergenic
1039550378 8:38439153-38439175 GGCTCCCAAAGTCACAAAACAGG + Intronic
1040316282 8:46262625-46262647 TGCACCCACAAGCAAAAAAAGGG + Intergenic
1040405547 8:47098622-47098644 AGCACCCAGATTCATAAAGCAGG - Intergenic
1040435346 8:47385398-47385420 AACACCCAAAACCAAAAAACTGG - Intronic
1040960022 8:53021589-53021611 AGCACCCAGATTCACAAAACAGG + Intergenic
1041037216 8:53805570-53805592 GGCACACAAACTGAAAAAACAGG + Intronic
1041360681 8:57050273-57050295 TGCATCCATATTGACAAAACTGG - Intergenic
1041760684 8:61362905-61362927 TTCACCCACATTCAGAAATCGGG - Intronic
1041842815 8:62291896-62291918 AGCACCCAGATTCATAAAGCAGG - Intronic
1042129932 8:65578590-65578612 TGAAAGCAAATTCAAAAACCTGG - Intergenic
1043703835 8:83324083-83324105 AGCACCCAGATTCATAAAGCAGG + Intergenic
1044127945 8:88481662-88481684 AACACCCAGATTCATAAAACAGG + Intergenic
1045143744 8:99315937-99315959 TGCAAACAAATTCAAAAAACTGG - Intronic
1047146483 8:122205194-122205216 TTCACCTAAATTAAAAAAAAAGG + Intergenic
1047909144 8:129507951-129507973 TGAAGCCAAATCCAAAATACAGG - Intergenic
1048158110 8:131982237-131982259 TTCACCCAAATTACAAAAACTGG - Intronic
1048395337 8:134009254-134009276 TGCCCGCAAATTCAAAAGACTGG + Intergenic
1048905452 8:139083675-139083697 GACACCCAATTTTAAAAAACTGG - Intergenic
1049891588 9:74562-74584 CGCACCCAAACTCCAAAACCAGG + Intergenic
1050380060 9:5019665-5019687 TGAAAGCAAATTCAAAAAAATGG - Intronic
1050428843 9:5540873-5540895 AGCACCCTAATACAAAAACCAGG + Intronic
1050971282 9:11878897-11878919 TTCAACAAAATTCAAAAAACAGG + Intergenic
1051240645 9:15051926-15051948 AGCACCCAAATTCATAAAGTGGG + Intergenic
1051303883 9:15686583-15686605 TGCACCCAATAAAAAAAAACTGG + Intronic
1051313939 9:15808816-15808838 TGTACCAAAATACAATAAACTGG + Intronic
1051347402 9:16164651-16164673 TGAACCCCAATTCAATATACTGG + Intergenic
1053573618 9:39335439-39335461 TGTTCCCAATTTCAAAAACCTGG - Intergenic
1053623908 9:39849127-39849149 TGCAACAAAGTACAAAAAACCGG + Intergenic
1053733017 9:41075656-41075678 CGCACCCAAACTCCAAAACCAGG + Intergenic
1053880961 9:42594102-42594124 TGCAACAAAGTACAAAAAACCGG - Intergenic
1053891709 9:42700224-42700246 TGCAACAAAGTACAAAAAACCGG + Intergenic
1054123526 9:61283570-61283592 TGTTCCCAATTTCAAAAACCTGG + Intergenic
1054219989 9:62401573-62401595 TGCAACAAAGTACAAAAAACCGG - Intergenic
1054230726 9:62507599-62507621 TGCAACAAAGTACAAAAAACCGG + Intergenic
1054695406 9:68355903-68355925 CGCACCCAAACTCCAAAACCAGG - Intronic
1055300696 9:74878637-74878659 TGCAAGCAAATTCAAAAGATTGG + Intronic
1055581652 9:77712454-77712476 TGCACCCAAACTCCTAACACAGG - Intergenic
1055617313 9:78086079-78086101 AGCACCCAGATTCATAAAGCAGG + Intergenic
1057610655 9:96540571-96540593 TGCACCCAAAGTCAATTAGCTGG - Intronic
1057763808 9:97898499-97898521 TGAACACAAAATTAAAAAACGGG - Intergenic
1058495652 9:105556467-105556489 AGCAACTAAATTCAGAAAACGGG - Intergenic
1059960592 9:119560603-119560625 TGCACCCAAATGCAAATAGAGGG + Intergenic
1062198926 9:135290493-135290515 TGCATCCAACTTCACCAAACTGG + Intergenic
1188876323 X:35434715-35434737 TGCACTCAAAAACAAAAATCAGG + Intergenic
1188921588 X:35985098-35985120 AGCACCCAGATTTATAAAACAGG - Intronic
1189076011 X:37915301-37915323 TGGCCCAAAATTCAAAAATCTGG - Intronic
1189509683 X:41649911-41649933 AGCACCTAGATTCAAAAAGCAGG - Intronic
1190144369 X:47877176-47877198 TGCACCCAAATTCAACTGATGGG - Intronic
1191084723 X:56552417-56552439 TGCACATAAAGTCCAAAAACAGG + Intergenic
1191602539 X:63025859-63025881 TGCATCCAAATTAAAAAAAGAGG - Intergenic
1191743397 X:64460350-64460372 TGCACACAAATTAGAAAATCTGG - Intergenic
1192291205 X:69796585-69796607 TGAATGCAAATTCAAAAAATTGG + Intronic
1192791735 X:74388633-74388655 TGCCCCCAAATTGGAAAGACTGG + Intergenic
1192932044 X:75816658-75816680 AGCACCCAGATTCATAAAGCAGG + Intergenic
1193086743 X:77453817-77453839 TGCTCTCAAATTCAAGAAACGGG - Intronic
1193233200 X:79073683-79073705 GGCACCCAGATTCACAAAACAGG + Intergenic
1193394297 X:80966146-80966168 AGCACCCAGATTCATAAAGCAGG - Intergenic
1193520368 X:82522728-82522750 TGAAAGCAAATTCAAAAAATTGG - Intergenic
1193906237 X:87248076-87248098 AGCAACAAAATTCAAAAAACGGG - Intergenic
1193945585 X:87729001-87729023 TGCACCCAAAGGCACAAAAGAGG - Intergenic
1194411461 X:93563623-93563645 TGCCCCCACATTAAAAAAAAAGG - Intergenic
1194434003 X:93848307-93848329 TGAATGCAAACTCAAAAAACTGG - Intergenic
1194900226 X:99500375-99500397 AGCACCCAGAGTCATAAAACAGG + Intergenic
1196536018 X:116845364-116845386 CACACCCAAATTCTAATAACTGG - Intergenic
1196725542 X:118891999-118892021 TGCACCCATAAACAAAAAACTGG + Intergenic
1197684620 X:129426735-129426757 TGAAAGCAAATTCAAAAAAGTGG - Intergenic
1199173099 X:144754990-144755012 AGCACCCAGATTCATAAAACAGG - Intergenic
1200035593 X:153327320-153327342 TGCACACAAATTAGAAAACCTGG - Intergenic
1200368222 X:155690674-155690696 AGCACCCAGATTCATAAAGCAGG + Intergenic
1200716972 Y:6557494-6557516 TGAAAGCAAATTCAAAAAATTGG + Intergenic
1201410424 Y:13693677-13693699 AGCACCCAGATTCATAAAGCAGG + Intergenic
1201536197 Y:15051342-15051364 AGCACCCAGATTCATAAAGCAGG - Intergenic
1201554083 Y:15250496-15250518 TGCCCCTAAATTTTAAAAACAGG - Intergenic