ID: 912183872

View in Genome Browser
Species Human (GRCh38)
Location 1:107251091-107251113
Sequence TTCAAATCATTCCAAATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912183872 Original CRISPR TTCAAATCATTCCAAATCAC TGG Intronic
900591190 1:3460782-3460804 CTCAGGACATTCCAAATCACTGG - Intronic
902088932 1:13886968-13886990 TTCAACTCAATGCAAAACACTGG - Intergenic
902351594 1:15859724-15859746 TTCAAATCAATCCAATATACAGG - Intronic
902483071 1:16722209-16722231 TACAAATCATCCCCAATCAGGGG - Intergenic
907629557 1:56066589-56066611 TGGAAATCATTCCAAATCATTGG - Intergenic
907938918 1:59068130-59068152 TATAAATCATTCCAAAGCCCTGG - Intergenic
908186672 1:61658977-61658999 TTGAAATCTTTCCAGACCACAGG + Intergenic
908276669 1:62480449-62480471 TTCAAATAATTACAAAACAAAGG + Intronic
912183872 1:107251091-107251113 TTCAAATCATTCCAAATCACTGG + Intronic
913043839 1:115056691-115056713 TTCCATGCATTCCTAATCACTGG + Intronic
913482658 1:119303690-119303712 TTCAAATAAATCCAAATTATAGG + Intergenic
913928599 1:124926362-124926384 TTCAAATCGCTCCAAATATCTGG - Intergenic
913929756 1:124941241-124941263 TTCAAATCGCTCCAAATATCTGG + Intergenic
913964463 1:143363950-143363972 GTCAAAACATTTCAAAGCACTGG + Intergenic
914058832 1:144189556-144189578 GTCAAAACATTTCAAAGCACTGG + Intergenic
914120317 1:144776815-144776837 GTCAAAACATTTCAAAGCACTGG - Intergenic
920947699 1:210545133-210545155 TTCAAAGCATTGGTAATCACTGG - Intronic
922298207 1:224270742-224270764 ATCAAATAATTTCAAATCACTGG + Intronic
1063551687 10:7039866-7039888 TTCATATCACTTGAAATCACTGG - Intergenic
1064835354 10:19522285-19522307 TACAAATCATACCAAAACAATGG - Intronic
1068058901 10:52041521-52041543 TTCAAACCATTCCAGATAACTGG - Intronic
1068158330 10:53230439-53230461 TTAAAATAATTCCAAACCAATGG - Intergenic
1068472679 10:57484909-57484931 TTTAAATCATTTCCAATCATGGG - Intergenic
1069530105 10:69211541-69211563 TACAAAACATTACAAGTCACTGG - Intergenic
1070018327 10:72557404-72557426 TTCAAATTACTCCCATTCACTGG + Intronic
1070326268 10:75391335-75391357 ATCAGCTCATTCCAAACCACAGG - Intergenic
1071465821 10:85938803-85938825 TTTAAAGCTTTCCAAATCACAGG - Intronic
1071711328 10:88052755-88052777 TTCCATTCATTGCAAATCACTGG - Intergenic
1071722799 10:88164335-88164357 CTCTAATAATTCAAAATCACTGG + Intergenic
1073418508 10:103404806-103404828 TTCAAATATTTCCACATAACTGG - Intronic
1073866237 10:107807574-107807596 TTCAAACTATTCCTAATCATAGG - Intergenic
1074456290 10:113598300-113598322 TTTAAATCCTGCCAATTCACTGG - Intronic
1075772456 10:124951372-124951394 TTAAAATCATTCCAGTTCAAAGG - Intronic
1075887717 10:125915877-125915899 TGCCAATCACTACAAATCACAGG - Intronic
1076040990 10:127248383-127248405 TTCCAATTATCCCAAAGCACAGG - Intronic
1076507996 10:130991007-130991029 TTCAAGTCTTTCCAAATGACCGG + Intergenic
1078483974 11:11705065-11705087 TTCCCATCATTCCAAGTGACTGG + Intergenic
1078987370 11:16608694-16608716 TTCAAATTATTATAAATAACAGG + Intronic
1079306874 11:19331144-19331166 TTCAAAACATTAAGAATCACAGG + Intergenic
1079525371 11:21380764-21380786 TTCAAGTCATTTCAATTAACTGG + Intronic
1081028247 11:38043172-38043194 ATCAAATCATTTCAAATGAAAGG - Intergenic
1081307765 11:41534513-41534535 TTCACATTATTCCAAATGATGGG - Intergenic
1081553770 11:44138729-44138751 TTCAAGTCTCTCCAACTCACAGG - Intronic
1082194306 11:49283586-49283608 TTTAATTCATGCCACATCACTGG - Intergenic
1084332611 11:68438691-68438713 TCCAGATCATTCCATATCTCAGG - Intronic
1085153267 11:74269114-74269136 TTCAGATCAGTCCAACTCCCTGG - Intronic
1086671847 11:89557454-89557476 TTTAATTCATGCCACATCACTGG + Intergenic
1087783132 11:102322198-102322220 TTAAAATCTTTCCCAAACACAGG - Exonic
1088961363 11:114669072-114669094 TTGAAATCATTCCAGAGCATAGG - Intergenic
1089314479 11:117582250-117582272 TTCAAACCATACCACATCCCAGG - Intronic
1090677314 11:129011630-129011652 TTCAAAACATTTTAAAACACTGG + Intronic
1090681875 11:129068260-129068282 TGCAAATCATTCAATATAACTGG - Intronic
1091123457 11:133075943-133075965 TTTAAGTCATCCCAAATAACAGG - Intronic
1091620357 12:2083171-2083193 CTCAAATCATTCCATACCAAAGG + Intronic
1092746523 12:11677577-11677599 ATCCAATCAATCCAACTCACTGG - Intronic
1094266188 12:28563208-28563230 TTCAAATTATTCCTTATCATAGG - Intronic
1096197189 12:49656303-49656325 TAAAAATCATTGCAGATCACAGG + Intronic
1097334307 12:58365231-58365253 CCCAAATCATTTCAAATCATTGG + Intergenic
1097998409 12:65915249-65915271 TTTAGATCATTTCAAAACACTGG + Intronic
1098030051 12:66244034-66244056 CTCAAATCATTCCAAGTTAGTGG + Intronic
1098710493 12:73752477-73752499 ATCAAATAATTCCAGATTACGGG - Intergenic
1099257027 12:80327142-80327164 TTCAATTTATTCTAAATCAAAGG - Intronic
1101007793 12:100418315-100418337 TTCAAATCATTGCTTATCAATGG + Intronic
1101703688 12:107199621-107199643 TTCATGTCATTGCAAATGACAGG + Intergenic
1104549863 12:129746530-129746552 TACAAAGCATTCCAACCCACTGG - Intronic
1105863339 13:24436815-24436837 TTTAAATCATTCATATTCACAGG - Intronic
1105870873 13:24505369-24505391 TACAAATCAATACAAATCATGGG - Intronic
1108728165 13:53203243-53203265 TTCAAATGATTGCAAAACAAGGG + Intergenic
1108801306 13:54098996-54099018 TTCAATTCATTCAAATTCAATGG - Intergenic
1110648898 13:77919790-77919812 TTCAAATGAACCCAAATCAAGGG + Intergenic
1110856619 13:80303770-80303792 TTCAAACTATTCCAGAACACAGG - Intergenic
1113339605 13:109409257-109409279 TTCAAATCTTTTCAAATAAAGGG + Intergenic
1113408119 13:110060699-110060721 TTTTAATTTTTCCAAATCACTGG - Intergenic
1113519035 13:110925245-110925267 GTTAAAGCATTCCAAGTCACAGG + Intergenic
1114992712 14:28307806-28307828 TTCAATTAATTACAAAACACAGG - Intergenic
1115607164 14:35014968-35014990 TGCAAATCATTTAAAATCTCAGG + Intronic
1116130192 14:40846548-40846570 TTCAAAACAATCTAATTCACTGG - Intergenic
1116214328 14:41991642-41991664 TTCAAACCATACCAATTCACAGG + Intergenic
1117262622 14:54051844-54051866 TTCCAAATATCCCAAATCACTGG - Intergenic
1117831052 14:59751491-59751513 TGCAAATAGTTCCAAATAACTGG - Intronic
1118150202 14:63180681-63180703 CTGAAATCCTTCCAATTCACAGG - Intergenic
1118848347 14:69565249-69565271 TTCCAACCATTCCAAATGAGGGG - Intergenic
1122258546 14:100498792-100498814 TAGAAACCATTCCAAATCAGGGG - Intronic
1202870428 14_GL000225v1_random:158189-158211 TGCCAATCACTACAAATCACAGG + Intergenic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1125824123 15:42661113-42661135 TACAAATCGTTCCAAATGACAGG + Intronic
1127247206 15:57190191-57190213 TTCATTTCATTTCAAATCAGTGG - Intronic
1132160055 15:99532512-99532534 TTCATGTTATTCCAAATGACAGG - Intergenic
1136087148 16:27893494-27893516 TTCAACTCTTTCCAAATGTCGGG - Intronic
1136513800 16:30755952-30755974 TTGAAATCAATCCAAAACCCAGG + Intronic
1139836103 16:69839888-69839910 TTCTAAACATTTCATATCACTGG - Intronic
1140712041 16:77687621-77687643 CCCAAATCCCTCCAAATCACTGG + Intergenic
1141053171 16:80791656-80791678 ATCATATCCTTCCAAATGACTGG - Intronic
1142057471 16:88007351-88007373 TTCACATCCTTCCAGATCTCGGG - Intronic
1144062945 17:11599306-11599328 TTCAGATCTTTCCAATTTACAGG - Intronic
1145177829 17:20717102-20717124 TCCATATCATTTCTAATCACTGG + Intergenic
1149199528 17:54166687-54166709 TTCATATTATTGCAAATGACAGG - Intergenic
1150255905 17:63743980-63744002 TTCACATCATTCAAAATGAGAGG + Intronic
1153131737 18:1861462-1861484 ATCACAGCATTCCAAGTCACAGG + Intergenic
1156216932 18:35008809-35008831 TGTAAATTATTCCAAATCTCTGG - Intronic
1156753395 18:40489698-40489720 TTCCAATCTTTCTAACTCACAGG - Intergenic
1156846179 18:41667825-41667847 TTCAAAGCATTCCAAATAAATGG + Intergenic
1158004742 18:52659619-52659641 TTTAATTCATTCCAAAGCTCAGG - Intronic
1158209744 18:55034880-55034902 TTCTAATGATTCATAATCACAGG - Intergenic
1161529208 19:4777049-4777071 TCCCAGTCATTCCAAATCGCAGG + Intergenic
1162848513 19:13412849-13412871 TTCAAATCTTTTTAAATCAGTGG - Intronic
1165131795 19:33637246-33637268 GTCAAGGCATTCCAAGTCACAGG - Intronic
1168303082 19:55418025-55418047 TTCAAAAGATTCCACATCATGGG + Intergenic
1168600877 19:57717638-57717660 TTCAAGTGATCCCAAAGCACTGG - Intronic
1202698235 1_KI270712v1_random:141441-141463 GTCAAAACATTTCAAAGCACTGG + Intergenic
925043767 2:755304-755326 AATCAATCATTCCAAATCACTGG + Intergenic
928430134 2:31210850-31210872 TGCAAAGCATGCCAAATCATAGG + Intronic
930176586 2:48307110-48307132 TTCCAGACATTCCAAATGACTGG + Intergenic
930776718 2:55179852-55179874 TTCAAAACATTATATATCACAGG + Intronic
931258943 2:60599959-60599981 TGCAAATCATTCCAAGTAGCTGG + Intergenic
932723659 2:74159040-74159062 TCCAAATAAGTCCAAGTCACAGG + Intronic
933385560 2:81606491-81606513 TTCAAATCATCCCTTCTCACTGG + Intergenic
934279487 2:91599224-91599246 GTCAAAACATTTCAAAGCACTGG + Intergenic
935371690 2:102354605-102354627 TACAATTCAATCCAAATCCCAGG - Intronic
935374566 2:102381313-102381335 GTCAAACCATGCAAAATCACTGG - Intronic
939929356 2:148214044-148214066 TTCAAATCATTCCATTTTAAAGG + Intronic
940860481 2:158765605-158765627 TTCTAATCCATCCAATTCACTGG + Intergenic
941019804 2:160396168-160396190 ATCAAACCATTTCAAAACACAGG - Intronic
941222412 2:162799713-162799735 TGCAAATCATAGCAAAACACAGG + Intronic
941788814 2:169528195-169528217 TTCAAATCATGCAAAGTCATTGG + Intergenic
941899117 2:170660797-170660819 TTTTAATCAAACCAAATCACAGG + Intergenic
942091854 2:172499834-172499856 GTCAAATCATTCCATCTCCCTGG + Intronic
943951899 2:194140611-194140633 TGCAAATCACTCCAATTGACAGG + Intergenic
944956443 2:204816684-204816706 ATCAAATCATTTAAAATCAGTGG - Intronic
945097546 2:206233726-206233748 TTCAAATCATTCCCAATTCTAGG - Intergenic
946216316 2:218186489-218186511 TTCAAATCAAACCAAATAACTGG + Intergenic
947350205 2:229235750-229235772 TTAAAATCATTCCAAGAAACTGG + Intronic
949019446 2:241733199-241733221 TTTGAATCATTCCTAATCCCAGG + Intergenic
1169301889 20:4449730-4449752 TTAAAAACATTCCAAATATCTGG + Intergenic
1169632891 20:7653001-7653023 TTCAACTATTTCCAAATCACAGG + Intergenic
1169709039 20:8540641-8540663 TTAAAATGTTTCCAAACCACTGG + Intronic
1170430446 20:16271014-16271036 TTTAAATTAGTCCAAATCAATGG + Intergenic
1171353718 20:24526362-24526384 TTCTAATCATTCTAAACCAGGGG - Intronic
1171888949 20:30690034-30690056 TTCAAACCATACAAAATCTCAGG + Intergenic
1172413483 20:34743922-34743944 TTAAAATTATTCCAATTCATTGG + Intronic
1173373066 20:42457595-42457617 TTTAAATATTTCCAACTCACAGG + Intronic
1174875682 20:54223873-54223895 TTCAAATCATTCCATCTTTCTGG + Intronic
1174918205 20:54675453-54675475 TTTAAACTTTTCCAAATCACTGG + Intergenic
1175014299 20:55772235-55772257 TTCAAACTATTCCAAATCTCAGG + Intergenic
1184151590 22:42642736-42642758 TTGAAATAATTTCAAATTACTGG - Intronic
1184662920 22:45973721-45973743 TTCAAATTGCTCCAAATCCCAGG + Intronic
1185130342 22:49035336-49035358 TTCAACTCCTTCCTAGTCACAGG + Intergenic
950267243 3:11583409-11583431 TCCATAACATTCCAAATCTCAGG + Intronic
950348171 3:12318906-12318928 TTTAAATTATTTCAGATCACAGG - Intronic
952070879 3:29634531-29634553 TTAAAATCATTCCAAAATAGGGG - Intronic
952416375 3:33094553-33094575 ATAAAAACATTCCAAATCAGCGG + Intronic
953864245 3:46570722-46570744 TTCATGTCATTGCAAATGACTGG - Intronic
954871726 3:53772465-53772487 ATCAAACCATTCCAGAACACTGG - Intronic
956321235 3:67999005-67999027 TAAAAATTATTCAAAATCACAGG + Intergenic
959472987 3:106775578-106775600 TTCAAATTATTACAGATCAATGG + Intergenic
959807815 3:110578502-110578524 TTCAATTAATTCCAAATGACTGG - Intergenic
962049077 3:131794013-131794035 TTCAAATAATTATAATTCACTGG + Intronic
969836695 4:9848174-9848196 TTGAAATCTTTCCAAAGCTCGGG - Intronic
971178115 4:24301253-24301275 ATAAAATCCTTCCAAATCATGGG - Intergenic
971509402 4:27405613-27405635 TTCAAATCATTCCAGTCCAGGGG + Intergenic
971795681 4:31224878-31224900 TTCAAATCAATCACAATAACAGG - Intergenic
972037878 4:34549690-34549712 TTGAAAATATTTCAAATCACTGG - Intergenic
972291485 4:37693939-37693961 TTCAAATCCTTACAACTCTCAGG - Intergenic
973897714 4:55432034-55432056 AACAAACTATTCCAAATCACTGG + Exonic
973939037 4:55884935-55884957 TTCAAACCATTTCAAATGTCTGG - Intronic
974420852 4:61671342-61671364 TACACATCTTCCCAAATCACAGG - Intronic
974496650 4:62637625-62637647 TTGAAAATATTCCAAATCACAGG + Intergenic
976840916 4:89431525-89431547 TTCAAATATCTTCAAATCACAGG + Intergenic
977802681 4:101256475-101256497 TTTAAAGCAATCAAAATCACTGG + Intronic
978010018 4:103669120-103669142 TTCATATCGTTGCAAATGACAGG + Intronic
978824142 4:113000601-113000623 TTCATATCATTCTATGTCACTGG - Intronic
979666573 4:123317276-123317298 TTCAAATCATTCTAAAGCCATGG - Exonic
980436508 4:132782556-132782578 TCCAATTCATTCCAAATAATAGG + Intergenic
980655880 4:135785374-135785396 TTCAAATCATTACAAGCCCCAGG + Intergenic
982185291 4:152790278-152790300 TTCAGATAATACCAAATAACAGG + Intronic
982799493 4:159686338-159686360 TTCAAAAAATTCCAAACCAGAGG - Intergenic
983100533 4:163620820-163620842 TTCCAATGATCCCAACTCACAGG - Intronic
984341467 4:178462396-178462418 TCCAAATCTTTCCAAATCGTAGG + Intergenic
985330151 4:188823029-188823051 TTCACATCTTTTCACATCACTGG - Intergenic
987165843 5:15197017-15197039 GTTAAAGCATTCCAAGTCACAGG - Intergenic
987623669 5:20369422-20369444 TTGACATCTTTCCAATTCACAGG + Intronic
987743420 5:21938840-21938862 TTCAAATAATTCTAATTCAAAGG - Intronic
988083480 5:26443120-26443142 TTCAAATCATCCCAAACTGCTGG - Intergenic
989757092 5:44968408-44968430 TTCCAATCATCCCCAGTCACTGG - Intergenic
991763617 5:69948977-69948999 TTCAAATAATTCTAATTCAAAGG - Intergenic
991783708 5:70169149-70169171 TTCAAATAATTCTAATTCAAAGG + Intergenic
991801072 5:70365478-70365500 TTCAAATAATTCTAATTCAAAGG + Intergenic
991827528 5:70644563-70644585 TTCAAATAATTCTAATTCAAAGG - Intergenic
991842847 5:70824045-70824067 TTCAAATAATTCTAATTCAAAGG - Intergenic
991876154 5:71169508-71169530 TTCAAATAATTCTAATTCAAAGG + Intergenic
992261277 5:74973022-74973044 CTCAAATCCTTGCAAAACACTGG + Intergenic
993371314 5:87096247-87096269 TGCAAATGATTCAAAAGCACTGG - Intergenic
994478604 5:100303266-100303288 TGTAAAACAATCCAAATCACAGG + Intergenic
994728065 5:103459810-103459832 TACACATCATTCCAAAGCACTGG - Intergenic
995382324 5:111548893-111548915 TTCACATCCCCCCAAATCACTGG - Intergenic
995892524 5:116970967-116970989 TTCAAATCCTTCAAATTCATGGG - Intergenic
995928903 5:117411396-117411418 TATAAATCATTTCAAATGACCGG + Intergenic
995945964 5:117645872-117645894 TTTGAATAATTCCAAATCATTGG - Intergenic
999885848 5:155921744-155921766 TTCAAATTCTTCATAATCACAGG + Intronic
1004373637 6:15073838-15073860 CCCCAATAATTCCAAATCACAGG - Intergenic
1004730040 6:18348619-18348641 CCCAAATCATTTCAAATGACTGG + Intergenic
1005008598 6:21314241-21314263 TACAATTCATTCCATATCAGGGG - Intergenic
1005272077 6:24176916-24176938 TTCATGTCATTGCAAATTACAGG + Intronic
1006861463 6:37174221-37174243 TACAACTCATTCCAGATCCCAGG + Exonic
1007348536 6:41251418-41251440 TTAAACTCATTCCAAATAAATGG - Intergenic
1008876727 6:56337796-56337818 TGCAAATAATCCCAAATCAATGG - Intronic
1009330052 6:62407579-62407601 TAGAAATCATTCCAAAGCCCTGG + Intergenic
1010939886 6:81904384-81904406 TTCAAATCATTTCATCACACAGG - Intergenic
1011037897 6:82997898-82997920 GTAAAATAATTTCAAATCACAGG - Intronic
1012865944 6:104617753-104617775 TTTAAATCTTTCCACAACACTGG + Intergenic
1013753373 6:113433205-113433227 TTCCAAACACTCCAACTCACTGG + Intergenic
1014166904 6:118235138-118235160 TCCAAATCATTCTAAATTTCAGG - Intronic
1014280401 6:119436938-119436960 TACAAAACATTCAAAATCATAGG - Intergenic
1015295753 6:131590466-131590488 TTTAAATAATTTCAAGTCACAGG - Intronic
1016229125 6:141781040-141781062 TTAAAATAATTCCAAATTTCTGG - Intergenic
1016984616 6:149885609-149885631 TTCAGCTCAATCCCAATCACAGG - Intronic
1018168163 6:161119707-161119729 TGCAATCCAATCCAAATCACAGG - Intergenic
1018676100 6:166223439-166223461 TTCAGATCATACCAAATTGCAGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1026333887 7:69377481-69377503 CTCAAATCATCACAAATCAGAGG + Intergenic
1028012743 7:85669415-85669437 TTTAAATTATGACAAATCACAGG + Intergenic
1028760191 7:94487479-94487501 TTCATGTTATTCCAAATGACAGG + Intergenic
1029066422 7:97853851-97853873 TTCATCAAATTCCAAATCACCGG + Intronic
1030362695 7:108611319-108611341 TTCATATCCTTACAAAACACAGG + Intergenic
1032374977 7:131404542-131404564 CTCAAATGATCCCAAAGCACTGG + Intronic
1032737709 7:134707908-134707930 CTCAAATCACTCCAAACCAAAGG + Intergenic
1032818383 7:135500941-135500963 TTAAAATCATTCAGAAACACTGG + Intronic
1033075210 7:138243455-138243477 TTTAAATGTTTCCAAATCACAGG - Intergenic
1033499656 7:141935107-141935129 TACAAATTCTTCTAAATCACAGG + Intronic
1033805399 7:144948618-144948640 TATAAATCATACCAAAACACTGG - Intergenic
1033907272 7:146220784-146220806 TTCCAATAATTCCAAATCCCAGG - Intronic
1035293309 7:157853740-157853762 CTCAATTCATCCCAAAACACGGG - Intronic
1036484208 8:9164964-9164986 TTCAAGGCTTTCCAGATCACTGG + Intronic
1037578801 8:20232418-20232440 TCCAAATCGTGCTAAATCACTGG + Intergenic
1038177768 8:25196832-25196854 TACAACTCATTCCAAAGAACTGG - Intronic
1038466169 8:27765864-27765886 ATCAACTCAATCCAAATCTCTGG + Intronic
1040727765 8:50403393-50403415 TTTAAATCATTCTGAATCATGGG + Intronic
1041078870 8:54195473-54195495 TTCATGTCATTGCAAATGACAGG + Intergenic
1041396939 8:57401371-57401393 TTCAGATCATTCCAAATTGAGGG + Intergenic
1042531063 8:69816340-69816362 TTCAAATCATTCTAAAACAGTGG - Intronic
1044058349 8:87600612-87600634 TTCAAATGTTTCCAAATTAGAGG + Intronic
1045405449 8:101862156-101862178 TTAAAATCAATCCAAAACAAAGG + Intronic
1045478290 8:102572065-102572087 TTAAAAGCAATCCATATCACTGG + Intergenic
1045896038 8:107218086-107218108 TTCAAATCATTCCATGTCTGAGG + Intergenic
1046485036 8:114875993-114876015 TACAACTCATTCAAAATCTCTGG + Intergenic
1047584492 8:126255020-126255042 TTCACATCCTTCCTAAGCACTGG + Intergenic
1047623582 8:126633503-126633525 TTGAAAACATACCAAATTACTGG - Intergenic
1048131140 8:131699048-131699070 TTAAAAGTAGTCCAAATCACAGG - Intergenic
1048891365 8:138951691-138951713 TTCAAATATTGCCAAATGACTGG + Intergenic
1049278325 8:141731095-141731117 TTTAATTCCTCCCAAATCACAGG - Intergenic
1051137741 9:13942008-13942030 TTCAACTCATTTCAAAGCAGAGG + Intergenic
1052544740 9:29861858-29861880 TTCAAAAACTTCCAAATTACTGG + Intergenic
1053322233 9:37109442-37109464 TTAAAACCTTTCCAAATCAAAGG + Intergenic
1054360514 9:64109930-64109952 TTCAAGCCATGCAAAATCACAGG - Intergenic
1055732284 9:79290730-79290752 TTAAAATCATTCAGCATCACTGG - Intergenic
1056008033 9:82294693-82294715 TTAAAATCATTTCAAATAATAGG - Intergenic
1056705111 9:88945441-88945463 ATCAAATCATTACAAAAAACAGG - Intergenic
1057247551 9:93469477-93469499 TTAAAATCATTAGAAATTACTGG - Intronic
1059028417 9:110662529-110662551 TTTATATTATCCCAAATCACAGG + Intergenic
1059221475 9:112624890-112624912 TTCACAGCATTGAAAATCACTGG - Intronic
1059947860 9:119430383-119430405 TTTAAATCATTTCAACTCAAGGG + Intergenic
1062665867 9:137671282-137671304 TCCAAAACATACAAAATCACTGG - Intronic
1203734027 Un_GL000216v2:118393-118415 TGCCAATCACTACAAATCACAGG - Intergenic
1186747529 X:12584725-12584747 TTCAAATAATTCTGAATCAAAGG + Intronic
1187712646 X:22069543-22069565 TCTAAATCATTCTAAATCATGGG - Intronic
1188341305 X:29005431-29005453 TTCCAATAATTTCAAATCAGAGG - Intronic
1188642616 X:32524712-32524734 TTCAAATCAATTCAAACAACAGG + Intronic
1188938702 X:36210336-36210358 TTCTAATTATTCCACATCATAGG + Intergenic
1189703613 X:43737308-43737330 AACAAATCATTCCCCATCACTGG - Intronic
1189857046 X:45233928-45233950 ATCAAATCCTACCCAATCACTGG + Intergenic
1190903646 X:54703535-54703557 TTTCAAGCATTCAAAATCACAGG - Intergenic
1191633237 X:63347545-63347567 TTTAAATTATTCCAGACCACAGG + Exonic
1193175907 X:78392315-78392337 CTCAAATAATTCCAAAACAGAGG + Intergenic
1193792436 X:85832009-85832031 TGCAAATAATTCTAAATAACTGG + Intergenic
1197507311 X:127321874-127321896 TTAAAATCAGTACAAATCAGAGG - Intergenic
1198322768 X:135535525-135535547 TTCATGTCATTCCATCTCACTGG + Intronic
1199195920 X:145030705-145030727 GTTAAATCATACAAAATCACTGG - Intergenic
1199535633 X:148899569-148899591 TTCAGATAATTTCAAATAACTGG - Intronic
1200560233 Y:4691778-4691800 CTCAAATCTTTCCAAATATCTGG + Intergenic
1201396551 Y:13554861-13554883 TTCAGTGCATTTCAAATCACTGG + Intergenic
1202626985 Y:56870018-56870040 TGCCAATCACTACAAATCACAGG + Intergenic