ID: 912185263

View in Genome Browser
Species Human (GRCh38)
Location 1:107267653-107267675
Sequence ACCTGAGGGCAAGAGTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912185263_912185267 21 Left 912185263 1:107267653-107267675 CCACCATACTCTTGCCCTCAGGT No data
Right 912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912185263 Original CRISPR ACCTGAGGGCAAGAGTATGG TGG (reversed) Intronic
No off target data available for this crispr