ID: 912185267

View in Genome Browser
Species Human (GRCh38)
Location 1:107267697-107267719
Sequence AACATAGAGCAATTAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912185266_912185267 6 Left 912185266 1:107267668-107267690 CCTCAGGTCTTTGAACGTGCTGC No data
Right 912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 82
912185264_912185267 18 Left 912185264 1:107267656-107267678 CCATACTCTTGCCCTCAGGTCTT 0: 1
1: 0
2: 0
3: 24
4: 316
Right 912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 82
912185261_912185267 30 Left 912185261 1:107267644-107267666 CCAGGGTGTCCACCATACTCTTG 0: 1
1: 0
2: 0
3: 14
4: 615
Right 912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 82
912185263_912185267 21 Left 912185263 1:107267653-107267675 CCACCATACTCTTGCCCTCAGGT No data
Right 912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 82
912185265_912185267 7 Left 912185265 1:107267667-107267689 CCCTCAGGTCTTTGAACGTGCTG No data
Right 912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912185267 Original CRISPR AACATAGAGCAATTAGCCCC TGG Intronic
904634510 1:31869428-31869450 ATTATAGAGAAATTGGCCCCAGG + Intergenic
909190641 1:72545226-72545248 AACATAGAGGATCTAGTCCCAGG + Intergenic
911075584 1:93870450-93870472 AACATACATCACGTAGCCCCTGG - Intronic
912185267 1:107267697-107267719 AACATAGAGCAATTAGCCCCTGG + Intronic
915801856 1:158801987-158802009 AACATATAGCAAGGAGCCCCTGG - Intergenic
915850045 1:159311854-159311876 AACTGAGAGCCATTAGCCCAAGG + Intergenic
919273355 1:195379980-195380002 ATCATAGAGACATTAACCCCTGG - Intergenic
920793067 1:209111024-209111046 AACATAGAACACTTTGCCTCTGG - Intergenic
922696409 1:227733215-227733237 AACCCAGAGCAAGTAGACCCAGG + Intronic
923614212 1:235523170-235523192 AAAATACAAAAATTAGCCCCAGG - Intergenic
1063969657 10:11372736-11372758 AACATTGAGGACTGAGCCCCGGG - Intergenic
1067963248 10:50880278-50880300 GACACAGAGAAATTTGCCCCAGG - Intronic
1068737761 10:60433429-60433451 AAAATATAAAAATTAGCCCCAGG + Intronic
1068950717 10:62774444-62774466 ACCTTACAGCCATTAGCCCCAGG + Intergenic
1071122376 10:82294117-82294139 GAGAAAGAGCAATTAGGCCCTGG + Intronic
1073910564 10:108338280-108338302 AACATGGAGCAATTATACCAGGG - Intergenic
1074054371 10:109908941-109908963 AACACAGAGCATTGAGGCCCTGG - Intronic
1081989009 11:47327689-47327711 AAGGTAGAGCAAGAAGCCCCAGG - Intronic
1083357834 11:62080359-62080381 AACATAAAAAAATTAGCCGCAGG - Intergenic
1084397464 11:68922384-68922406 AACATGAAGCAAATAGCACCAGG - Intronic
1086589562 11:88496028-88496050 AACACAGAGCACTTTGCCCTGGG - Intergenic
1095312024 12:40710273-40710295 AAGATGGAGGAATTAGCCCTTGG + Intronic
1096296779 12:50390846-50390868 AACATACAACAATTAGCCAGGGG - Intronic
1098013766 12:66082444-66082466 AAAATACAAAAATTAGCCCCAGG + Intergenic
1099359951 12:81687676-81687698 AACATAAAGCAATTAGCCTAAGG - Intronic
1099380279 12:81944607-81944629 CACACAGGGCAATCAGCCCCTGG + Intergenic
1109014160 13:56987053-56987075 AAAATACAGAAATTAGCCACAGG + Intergenic
1118191230 14:63582483-63582505 AAAATACAAAAATTAGCCCCGGG - Intergenic
1119282490 14:73421721-73421743 AACAAAGTACAATTTGCCCCAGG + Intronic
1129493282 15:75950755-75950777 ACCATAGAGCAATTATTCCATGG - Intronic
1139193157 16:64888299-64888321 AAAATACAGAAATTAGCCACAGG - Intergenic
1141324356 16:83041616-83041638 AACAGGGGGCAATTAGCTCCAGG - Intronic
1143091884 17:4453795-4453817 GAAATAGAGCAATTCTCCCCAGG + Intronic
1148773733 17:50081561-50081583 CACCCAGAGCAATTAACCCCGGG + Intronic
1150593312 17:66581965-66581987 GACATTTAGCCATTAGCCCCAGG + Intronic
1150722604 17:67626330-67626352 AACATGCAGGAATTAGCCCAAGG + Intronic
1151529755 17:74696658-74696680 GACATAGAGCAAGTGCCCCCCGG - Intronic
1155237023 18:23830747-23830769 AACATAGAGTAATAAGGCCTAGG - Intronic
1158598671 18:58838504-58838526 AAGACAGCGCAGTTAGCCCCTGG - Intergenic
1160751010 19:734543-734565 AACATAAAAAAATTAGCCGCCGG + Intronic
1162009798 19:7805665-7805687 AACATTTAACAAATAGCCCCTGG + Intergenic
1162378371 19:10317921-10317943 AAAATGGAGCAATTGGCCCTAGG - Intronic
1164534285 19:29073533-29073555 ATCATAGAGGAATGAGCCACTGG - Intergenic
1165932151 19:39366511-39366533 AGCTTAGAGCAAAGAGCCCCAGG + Intronic
1168234427 19:55053055-55053077 AACACAAAGCAAAGAGCCCCAGG - Intronic
925661631 2:6209228-6209250 TGCATAGAGCAATGAGGCCCTGG - Intergenic
925995863 2:9292592-9292614 AACAGACAGGCATTAGCCCCAGG - Intronic
932997592 2:76875120-76875142 CACATAGATCAAATAGCCACAGG + Intronic
933280955 2:80332077-80332099 ATTATAGAGCAATTAGACCAAGG - Intronic
942517563 2:176769700-176769722 AACGGAGAGCAAATAGTCCCGGG + Intergenic
944670023 2:201986841-201986863 AAAATACAACAATTAGCCCGGGG + Intergenic
945109968 2:206353368-206353390 AAAATACAAAAATTAGCCCCAGG - Intergenic
948761683 2:240196230-240196252 AGCATTCAGCATTTAGCCCCTGG + Intergenic
1174219998 20:48946663-48946685 AAAATAGAAAAATTAGCCCGTGG - Intronic
1182344674 22:29653283-29653305 AAAATACAGAAATTAGCCCGGGG + Intronic
953041531 3:39258916-39258938 AACAGAGACCACTTAGCACCTGG - Intergenic
954323045 3:49844904-49844926 AACATAGAGCGATGAGGCCAAGG - Intronic
954345887 3:49998999-49999021 AAAAAAAAGCAATTATCCCCAGG - Intronic
956976420 3:74586150-74586172 AAAGTAGGGCAAGTAGCCCCAGG + Intergenic
965840946 3:172904958-172904980 AACACAGATCCATTAGTCCCAGG + Intronic
966853150 3:184176736-184176758 AACAGAGAGAGATTAGGCCCAGG - Intronic
972718906 4:41676124-41676146 AACACAAAGTAATTAGCCACTGG - Intronic
972783474 4:42306176-42306198 ATTATAGAGCATTTAGCTCCAGG + Intergenic
973774391 4:54231308-54231330 AACATTGAGCAATTTGGCCTCGG - Intronic
973969204 4:56194353-56194375 AACATGGAGCAATTAAGCCAAGG + Intronic
976475672 4:85479999-85480021 AACTTAGAGCAATTAGCGATTGG - Intronic
979321292 4:119328083-119328105 AATATAAAGCAAATAGCCCTTGG + Intergenic
981287321 4:143033686-143033708 ATCACAGATCATTTAGCCCCAGG - Intergenic
985967745 5:3350657-3350679 AACATAAAGCCATTAGCCACTGG + Intergenic
990729199 5:58789869-58789891 AACATAGAGAAATAATGCCCTGG - Intronic
995218269 5:109619658-109619680 AACATAGAGAAATGAGCCAGAGG + Intergenic
1001762353 5:174218743-174218765 CACATAAAGCAGTTAGCACCAGG + Intronic
1008425942 6:51356815-51356837 AACATAAAGCAATTTTCCCAAGG - Intergenic
1010622796 6:78098294-78098316 AACATAGACCAATGAACCTCAGG + Intergenic
1011621101 6:89243281-89243303 AACATAAAGTCATTTGCCCCAGG + Intergenic
1013160594 6:107540343-107540365 AACAAAGAGCAAAGAGCCCGAGG - Intronic
1014627250 6:123742009-123742031 AACATACAGCTATAAGCCCCAGG - Intergenic
1015480354 6:133701659-133701681 AATAGACAGCAATTAGCACCGGG - Intergenic
1019014726 6:168871662-168871684 AGCATTGAGCAAATAGACCCTGG + Intergenic
1019716120 7:2540222-2540244 AAAATAGAAAAATTAGCCCCAGG - Intronic
1022952031 7:35348306-35348328 AACATAGAGTAAATAGATCCTGG + Intergenic
1027706709 7:81543623-81543645 AACATTGAGTCATTAGCCCCAGG + Intergenic
1046597952 8:116283479-116283501 AACATTGAGAAATTACACCCAGG + Intergenic
1051616333 9:19010397-19010419 AAGAAACAGCAAATAGCCCCTGG - Intronic
1057562536 9:96139837-96139859 AACATAAATAAATTAGTCCCGGG - Intergenic
1059489589 9:114656225-114656247 AACATGGAGCAATTAGACCCTGG - Intergenic
1188656877 X:32708226-32708248 ATCATTGAGTAATTTGCCCCAGG - Intronic
1188997422 X:36903261-36903283 AACAGAGTGCAATCAGCACCAGG + Intergenic
1193027103 X:76856199-76856221 TGCATAGAGCAATAAGGCCCTGG + Intergenic
1195838803 X:109149894-109149916 TACATAGAGCAGTTAGCCCTGGG - Intergenic
1197679570 X:129367809-129367831 AACATCTAGCATTTAGCCACTGG - Intergenic