ID: 912185659

View in Genome Browser
Species Human (GRCh38)
Location 1:107272846-107272868
Sequence GCTTAAGCATTTGTACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912185659_912185660 -2 Left 912185659 1:107272846-107272868 CCATTAAGTACAAATGCTTAAGC 0: 1
1: 1
2: 0
3: 13
4: 148
Right 912185660 1:107272867-107272889 GCAGCTTAAAGCCCTGAAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 134
912185659_912185663 17 Left 912185659 1:107272846-107272868 CCATTAAGTACAAATGCTTAAGC 0: 1
1: 1
2: 0
3: 13
4: 148
Right 912185663 1:107272886-107272908 TCGGAAGCACTTAGAAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912185659 Original CRISPR GCTTAAGCATTTGTACTTAA TGG (reversed) Intronic
900822385 1:4899569-4899591 GCTTCAGCATTTGAATTCAAGGG + Intergenic
907211995 1:52831839-52831861 CCTTAAGCTTTTGTTATTAAAGG - Intergenic
908343799 1:63210606-63210628 GCTAAAGCTTATGTACTCAAGGG + Intergenic
908720320 1:67118615-67118637 GCTTCAGCATTTGAATTTGAGGG - Intronic
910340745 1:86184170-86184192 GCTGAAAGATTTGGACTTAATGG + Intergenic
911657939 1:100465929-100465951 TTTTAAGCATTTGTAATTAAAGG - Intronic
912185659 1:107272846-107272868 GCTTAAGCATTTGTACTTAATGG - Intronic
916697546 1:167254661-167254683 GCTTTAGCAGTTGAACTTACAGG + Intronic
918465233 1:184814925-184814947 CCTTAAGCTTTTGTTATTAAAGG + Intronic
919161319 1:193834588-193834610 GCTTGAGCATTTCTACTCACTGG + Intergenic
920124232 1:203680930-203680952 GGTTAAGGAGTTCTACTTAAGGG + Intronic
922643834 1:227264725-227264747 GATTAAGAATATGTACATAATGG - Intronic
923965426 1:239133365-239133387 TCTTAAGCATTTTTGCTTGAAGG - Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1064313189 10:14230339-14230361 GGACACGCATTTGTACTTAATGG - Intronic
1065171295 10:23033050-23033072 GACAAAGCATTTTTACTTAATGG - Intronic
1069219611 10:65867210-65867232 GAGTACCCATTTGTACTTAAGGG + Intergenic
1070431869 10:76348407-76348429 GCTTAAGCACTTTTACTTTATGG - Intronic
1071158119 10:82714951-82714973 GATTAAGCATTTGTAGTAAAAGG - Intronic
1072030561 10:91517956-91517978 GATTTTGCATTTCTACTTAAAGG + Intergenic
1073817378 10:107222971-107222993 CCTTAAGCATTTGAACTGAAAGG - Intergenic
1073964643 10:108975066-108975088 TCTTTTGCATTTGTATTTAAAGG + Intergenic
1074033167 10:109709477-109709499 GCTTAATCATTTGTAGTTTTTGG + Intergenic
1074657299 10:115606453-115606475 ACTTAAACATTTGCTCTTAATGG - Intronic
1075347010 10:121690188-121690210 GCTGAAGCATTTGTATGAAAAGG - Intergenic
1078540270 11:12207409-12207431 GCATACGCATTTGTGCTGAATGG + Intronic
1079791044 11:24739545-24739567 GCTTTAACATTTGTTCTTCATGG - Intronic
1080223790 11:29936943-29936965 TCTTAACCATTTGTAGTTAGAGG - Intergenic
1082797748 11:57390229-57390251 GCTTATTTGTTTGTACTTAATGG + Intronic
1084079603 11:66812734-66812756 GGTTAAGCAGTGGTTCTTAATGG + Intronic
1087039747 11:93786925-93786947 GTTTAACCACTTGTATTTAACGG - Intronic
1087890180 11:103529176-103529198 ATTTAAGCTTTTGTATTTAACGG - Intergenic
1089097886 11:115934702-115934724 GATTAAGCATTTGGAGTTCAGGG + Intergenic
1090440026 11:126717766-126717788 GCCTCAGCATCTGAACTTAATGG + Intronic
1093512415 12:19945017-19945039 CCTTAAGCAATTGTCCTAAAGGG - Intergenic
1093749023 12:22777701-22777723 GATTGAGCATTTGTAATTTATGG + Intergenic
1095549118 12:43412316-43412338 GCTTGAGCATTTTTATTTAAAGG + Intronic
1098432493 12:70435043-70435065 GCAGAAGCAATTGTACTTCAGGG + Intergenic
1099011280 12:77294245-77294267 GCTTCAACATTTGGACTTGAAGG - Intergenic
1101135990 12:101743628-101743650 GATTAAGCATTTAAACTAAAGGG - Intronic
1104381295 12:128310241-128310263 GCTTCATCCTTTGTATTTAATGG - Intronic
1107316112 13:39133838-39133860 GCTTCAGCATTTGAATTTTAGGG - Intergenic
1109002464 13:56823441-56823463 CATTTAGCATTTATACTTAAGGG + Intergenic
1110508101 13:76313713-76313735 GCTTAAGTATGTGTAGTTTAGGG - Intergenic
1115336818 14:32250432-32250454 GCTCAAGCATTTGCACTAAGAGG - Intergenic
1116470642 14:45281935-45281957 TCTTATGCAGTTGTACATAAGGG + Intergenic
1116949180 14:50863318-50863340 GCTGAAGCATTGGTACTGACAGG - Intronic
1116978257 14:51140116-51140138 GCTTAGGAATTTGTAATTCATGG + Intergenic
1117099762 14:52334267-52334289 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1121038692 14:90727476-90727498 GCTTAAACACTTGTCCTTCATGG - Intronic
1121768203 14:96505771-96505793 CTTTCAACATTTGTACTTAACGG + Intronic
1123909427 15:24952323-24952345 ACTTAAGGTTATGTACTTAAAGG - Intronic
1125961877 15:43837106-43837128 GCTTTAGGATTTGAACTCAAGGG + Intronic
1127142422 15:55991702-55991724 GCTGAAGGATTTGTACTTCTAGG - Intronic
1127170480 15:56295609-56295631 GCTTTTGCCTTTGTACCTAAAGG + Intronic
1127443109 15:59031696-59031718 GCTTAAACATTTTTACCTGAGGG - Exonic
1133725826 16:8536614-8536636 GAATAAGCATCTGAACTTAAGGG - Intergenic
1134905195 16:17973819-17973841 GCTTCAGCATCTGTATTTTAGGG + Intergenic
1137246355 16:46708941-46708963 GCTTAAGCATATGTTCTCAGTGG - Intronic
1137746237 16:50822278-50822300 GCTTAAGCATGAGCACTTAGAGG - Intergenic
1138243483 16:55447684-55447706 GCTTAATCATTTGCACCTCAAGG - Intronic
1139017221 16:62705000-62705022 GCTTAAACATTTTTAGTGAAAGG + Intergenic
1141093535 16:81146992-81147014 GCTTAAGCATTCCTTCTTCAGGG - Intergenic
1141200053 16:81890730-81890752 GCTAAAGCATTTTTTTTTAAGGG + Intronic
1149285058 17:55153345-55153367 GCTTTAGCATTTATACATGACGG + Intronic
1153175503 18:2367735-2367757 GCTCCAGCATGTGTACTAAAAGG + Intergenic
1154024957 18:10698319-10698341 TCTGAAGCTTTTGTACTTACGGG - Intronic
1155855001 18:30822087-30822109 ACATCAGCATTTGTACTTGAAGG + Intergenic
1156133877 18:34012062-34012084 GCATAGGCACTTGTAATTAATGG + Intronic
1157104493 18:44760533-44760555 GAATAAGCATTTAAACTTAAAGG - Intronic
1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG + Intergenic
1160076737 18:75684558-75684580 GCTTAGTCTTTTGTACGTAAGGG + Intergenic
924964364 2:61482-61504 GCAAAAACATTTTTACTTAATGG - Intergenic
925265732 2:2565283-2565305 GCTTCAGCATATGAATTTAAGGG - Intergenic
926040292 2:9667301-9667323 GATTAAGCATTTGTACAACAAGG + Intergenic
929110090 2:38398964-38398986 GCTAAAGGATTTGTACTCAATGG - Intergenic
932113638 2:69024648-69024670 GCTTAAGCAGCTGGACTTATAGG - Intronic
932965160 2:76465507-76465529 CCTTAGGCTTTGGTACTTAAAGG - Intergenic
933192046 2:79345605-79345627 GCTTAATCATTTGTTCTGAGGGG + Intronic
937580872 2:123485971-123485993 GCTTCAGCATTTGTAGTTGGAGG + Intergenic
942440657 2:176032161-176032183 GCTTAAGAAAATGTACTTAGGGG - Intergenic
1171052706 20:21874857-21874879 AATTTAGCACTTGTACTTAAAGG + Intergenic
1172188297 20:33045499-33045521 TCTTATGCAGTTGTACATAAGGG + Intergenic
1175025565 20:55898869-55898891 GCTTAATCATTTGTACCTTTTGG + Intergenic
1175619117 20:60428473-60428495 GCTTAATCATTTATACTCTAGGG + Intergenic
1176291287 21:5046272-5046294 GCTCAAGCATGTGTATTAAAAGG - Intergenic
1177020418 21:15849001-15849023 GCTTAAGTATTTGTACTTAATGG + Intronic
1177265365 21:18776330-18776352 ACTTAAACATTTTTACTTAGAGG + Intergenic
1177701242 21:24641867-24641889 GATTAAGCATTCTAACTTAAAGG - Intergenic
1178563477 21:33661352-33661374 CATTAAGCATGTGTACTCAAGGG + Intronic
1179865968 21:44217369-44217391 GCTCAAGCATGTGTATTAAAAGG + Intergenic
949111465 3:266217-266239 GCTTAAGCCTCTGTTCCTAAAGG + Intronic
951145123 3:19217710-19217732 GCTTCAGCGTCTGTACTTACAGG + Intronic
951250206 3:20385746-20385768 CCTTAAGCTTTTGTTATTAAAGG + Intergenic
959865739 3:111267942-111267964 GCTTAAACATCTGTATTTTATGG + Intronic
960642054 3:119834644-119834666 AATTAAGCATTTTAACTTAAAGG - Intronic
960822085 3:121745126-121745148 GCTTAAGCATGGCTACTTACTGG - Intronic
964450092 3:156803869-156803891 CCTTAAGCCTTTGTACTTTCTGG - Intergenic
964907120 3:161730675-161730697 GCTTAAGTATTTGAGTTTAAAGG + Intergenic
965340161 3:167480823-167480845 GATAAAGCATTTGTACTTCATGG - Intronic
967461933 3:189757938-189757960 GCTCAAGCATGTGTACTAAGGGG + Intronic
970953939 4:21788743-21788765 ACATAAGCATATCTACTTAATGG - Intronic
972229686 4:37056838-37056860 ACTTAAGCATTGATAGTTAAAGG - Intergenic
976901933 4:90188914-90188936 GATTAAGCATTGGTAACTAATGG + Intronic
977165025 4:93684443-93684465 ACTCAAGCATTTGTAGTCAATGG - Intronic
977526355 4:98150916-98150938 TTTTAAGCATTTGTAGTCAATGG - Intergenic
977755034 4:100659290-100659312 GATTAGGCATTTGTAATTAAGGG - Intronic
977769678 4:100843058-100843080 GCTTAAGTGTTTGTCCATAAAGG + Intronic
979302631 4:119104710-119104732 GCTTAATCATTTATACTCTAGGG - Intergenic
979318687 4:119298486-119298508 ATAAAAGCATTTGTACTTAAAGG - Exonic
979627589 4:122863060-122863082 GTTTAAAAATTTGTACTTTAGGG + Intronic
980080182 4:128335952-128335974 GCTTAAGCATTAGAGATTAAAGG - Intergenic
982407058 4:155032528-155032550 GCCTTAGCATTTTTACTTCAGGG + Intergenic
982766469 4:159354692-159354714 GCTTCATAATTTCTACTTAATGG + Intronic
983056699 4:163105484-163105506 GCTGACGCATTTTTAGTTAAGGG - Intergenic
983847856 4:172541842-172541864 GCTCAAGCATGTGCACTAAAAGG - Intronic
984091874 4:175385591-175385613 GCTTATGGTTTTATACTTAAGGG - Intergenic
984670818 4:182485228-182485250 GCTGATGCATTTGTAATGAAGGG - Intronic
990216562 5:53539121-53539143 GCTTATTCATTTGTACATTATGG + Intergenic
991932110 5:71763604-71763626 GATTGTGCATTTATACTTAATGG - Intergenic
993425565 5:87760175-87760197 GCTTAATCATTTGTTCTTCCAGG - Intergenic
993681940 5:90889478-90889500 GTTTAAGAATATATACTTAAGGG - Intronic
994281395 5:97907782-97907804 GCTTAAGCATGTGCACTAAGAGG + Intergenic
994945578 5:106384338-106384360 GTTTAAACATTTCTACTTGATGG - Intergenic
1001928125 5:175653966-175653988 GCTAGAGCATTTGCACTTATTGG + Intergenic
1003204297 6:3993013-3993035 GCTCAAGCATGTGCACTCAAAGG - Intergenic
1003727035 6:8776572-8776594 ACTTTAGCATTAGTATTTAAGGG + Intergenic
1005590270 6:27317452-27317474 GCTTATACATTTGTACTACAAGG + Intergenic
1008034251 6:46729646-46729668 GCTTAAGAATTCCTACTTTAGGG - Intronic
1008290263 6:49706256-49706278 GCCTAAACATTTTTCCTTAAAGG - Intronic
1009764946 6:68060424-68060446 GGTTAAGGCTTTGTATTTAAAGG - Intergenic
1011041802 6:83037625-83037647 CATGAAGCAATTGTACTTAAGGG - Intronic
1014112060 6:117629319-117629341 GCTTGAACATTTACACTTAATGG - Intergenic
1015103685 6:129511007-129511029 GCTTCAGCTTTTGCACTTAATGG + Intronic
1019182780 6:170201839-170201861 TCTTAAGCATTTTTACATAAGGG - Intergenic
1020368785 7:7410695-7410717 ACTTTGGCATTTGAACTTAAAGG - Intronic
1023052188 7:36262754-36262776 GCTCAAGCATGTGTACTTAGAGG - Intronic
1024161698 7:46682646-46682668 TTTTAAGCATTTATACTGAAGGG - Intronic
1038120625 8:24610465-24610487 ACTTAAGCATTTGTAGATAATGG - Intergenic
1039655357 8:39399174-39399196 GCTTAAACATATGTATTTAGGGG + Intergenic
1044830080 8:96238663-96238685 GCTTAAGGATTTGCACATCAGGG - Intergenic
1045110708 8:98937496-98937518 GTTAAAGTATTTGTATTTAATGG - Intronic
1046191328 8:110798736-110798758 GCTTATGCATTTGTAGATAAGGG - Intergenic
1048977826 8:139682843-139682865 ACCTAAGCATTTGTTTTTAAAGG - Intronic
1053167916 9:35857598-35857620 ACTGAAGAATTTGGACTTAATGG + Intergenic
1055928512 9:81535831-81535853 GCTTAAGAATTTGTATTAGAAGG + Intergenic
1058420807 9:104831392-104831414 GATTTAGCATTTCTACTCAAGGG - Intronic
1059267511 9:113049552-113049574 GCCGCAGCATTTGTACTTCAGGG + Intronic
1060448734 9:123716927-123716949 GATTAGTCATTTGCACTTAACGG - Intronic
1060670445 9:125464592-125464614 GTTTAAGGACTTGAACTTAATGG - Intronic
1060777835 9:126389528-126389550 GCTTAAGCATGTGTAATCAGTGG + Intronic
1061650215 9:132041711-132041733 GCTGAAAAATTTGTTCTTAAGGG + Intronic
1062125537 9:134858945-134858967 GCTTAAGCATTGGGTCTCAATGG - Intergenic
1186035785 X:5421979-5422001 GCTCAAGCATGTGCACTAAAAGG - Intergenic
1186051706 X:5603523-5603545 ACTTAAGCATTTGTCCTGACAGG + Intergenic
1188905770 X:35789429-35789451 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1190099946 X:47514945-47514967 GATTAAGTGTTTGTAATTAAGGG - Intergenic
1190937688 X:55011221-55011243 GCTAAAACATTTGTACTGATAGG - Intronic
1196674965 X:118409967-118409989 CCTTAATCATTTTTACTTACTGG - Intronic
1197593808 X:128442663-128442685 GCATAAGAATTTCTACTTCAGGG + Intergenic
1198001146 X:132438000-132438022 GCTTAACCTGTAGTACTTAAAGG - Intronic
1198451820 X:136774167-136774189 TTTTAAGCATTGGTGCTTAAAGG + Intronic
1200492938 Y:3850711-3850733 GCTTAAGCATGTGCACTAAGAGG - Intergenic