ID: 912186849

View in Genome Browser
Species Human (GRCh38)
Location 1:107287600-107287622
Sequence TCTTAAATTTAGAGGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912186843_912186849 27 Left 912186843 1:107287550-107287572 CCAGCCTGGGCAATGTAGTGAGA 0: 271
1: 2489
2: 16585
3: 65137
4: 156995
Right 912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG 0: 1
1: 0
2: 0
3: 19
4: 186
912186844_912186849 23 Left 912186844 1:107287554-107287576 CCTGGGCAATGTAGTGAGACCTT 0: 29
1: 368
2: 2755
3: 12564
4: 38340
Right 912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG 0: 1
1: 0
2: 0
3: 19
4: 186
912186846_912186849 4 Left 912186846 1:107287573-107287595 CCTTGGTCTCTATAAAACAAACA 0: 1
1: 1
2: 7
3: 64
4: 648
Right 912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG 0: 1
1: 0
2: 0
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912186849 Original CRISPR TCTTAAATTTAGAGGGTTGA TGG Intronic
905271533 1:36790796-36790818 GCTTAAATTAAGATGGTAGAGGG + Intergenic
905716400 1:40154437-40154459 TCTGAAATGGAGAGGTTTGAGGG + Intergenic
907489051 1:54797290-54797312 GTGTATATTTAGAGGGTTGATGG + Intronic
908708259 1:66984944-66984966 ACTAAAATTTTCAGGGTTGATGG + Exonic
910130746 1:83902409-83902431 TCATAAATTTAGAGGGGTGGTGG - Intronic
910454975 1:87387914-87387936 TCTTAATCTTACAGGGTTGGTGG - Intergenic
910637231 1:89422295-89422317 TCTCAAATTTATATGGTTTAGGG + Intergenic
912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG + Intronic
915494399 1:156271138-156271160 TATTAAATTTAGCTTGTTGAGGG - Intronic
917188696 1:172390513-172390535 ACTGAAATCTAGAGGGTAGAGGG - Intronic
921830545 1:219723594-219723616 TGTTAAATTTTGTTGGTTGATGG - Intronic
921906115 1:220497212-220497234 TCCCAACTTTAGAGAGTTGATGG + Intergenic
924114402 1:240730887-240730909 TTTTAAATTTAGAGATTAGAGGG - Intergenic
1063239146 10:4150556-4150578 TCCTAATTCTAGAGGTTTGAAGG - Intergenic
1064203528 10:13303468-13303490 TTTTAAAATTAGAGGGATGCTGG + Intergenic
1064487044 10:15804206-15804228 GCTTAAATGCAGAGGGTTGGCGG + Intronic
1065108843 10:22420075-22420097 TTTTAATTTTAGTGGGTTTAGGG + Intronic
1065262785 10:23942558-23942580 TCATAAATTTAGAGATTTGGGGG - Intronic
1065548273 10:26844229-26844251 TCATTAATTTAAAGAGTTGAGGG - Intronic
1068042343 10:51840844-51840866 TCTTTAAAATAGAGGGTTCAGGG - Intronic
1068946152 10:62730982-62731004 TGTTAAATCTAGGTGGTTGATGG - Intergenic
1071661889 10:87512623-87512645 TGTTAATTTTAGAGGGTTCAAGG - Intronic
1071855247 10:89617946-89617968 TCCTGACTTTAGAGAGTTGAGGG - Intronic
1078807724 11:14723291-14723313 TCTTAAATTTTGATGGATGCTGG + Intronic
1080121996 11:28689199-28689221 TCTCAAATTTATCCGGTTGACGG + Intergenic
1080127231 11:28751135-28751157 TATTAAATTTACATGGTTAAGGG - Intergenic
1081816745 11:45948940-45948962 TCTTACGCTTTGAGGGTTGAAGG + Exonic
1083334681 11:61915721-61915743 TCTTAAAGGGAGAGAGTTGAAGG - Intronic
1087417433 11:97875211-97875233 TCCTAAATTTTGATGGTTGCTGG + Intergenic
1087448996 11:98293616-98293638 TTTTAAATTTAGACGTTTAAGGG + Intergenic
1087758572 11:102080985-102081007 TCTTACAGTTAGAAGGTTTAAGG - Intronic
1088013558 11:105033265-105033287 TCTTTAATTTAGAGAGTGGTGGG + Intronic
1088016682 11:105069638-105069660 TCTTTAATTTAGAGAGTGGTGGG + Intronic
1088019233 11:105099556-105099578 TCTTTAATTTAGAGAGTCGTGGG + Intronic
1088354019 11:108922652-108922674 TGATAATTTTAGAGGGTCGAAGG - Intronic
1090059780 11:123454280-123454302 TCTTAAATTTAAAGGGGAGAGGG - Intergenic
1090111070 11:123910202-123910224 TTTAAAATTTTGAAGGTTGAAGG + Intergenic
1091604267 12:1936774-1936796 TCTTACAATTAGAGGAGTGAGGG - Intergenic
1093093460 12:14946562-14946584 TCTCTAATTCAGAGGTTTGATGG - Intronic
1095187571 12:39218834-39218856 TGTTAAATTTACAGGGTCAATGG - Intergenic
1097133655 12:56833704-56833726 GCCTAAGTTTAGAGGGTTAAAGG - Intergenic
1098185477 12:67891884-67891906 TTTAAAATTTAGGGGCTTGAGGG + Intergenic
1099141479 12:78981891-78981913 TCTTAAATTTGGATAGTTGAAGG + Intronic
1101590724 12:106122864-106122886 TCTTAAATTTTCAGGGATGTGGG - Intronic
1104507334 12:129344598-129344620 TCTAAGATTTAGGGGGTTGGAGG + Intronic
1104509412 12:129362913-129362935 AATTAAAGTTAGAAGGTTGAAGG - Intronic
1108863665 13:54895343-54895365 TTTTAAATTTAAAGGTCTGAAGG - Intergenic
1109389848 13:61678956-61678978 CCTTAAATCTAAAGGGGTGAGGG + Intergenic
1109456945 13:62605512-62605534 AATTAAATTTAGAGGCTTAAGGG + Intergenic
1109974694 13:69815851-69815873 TTTTATATTTAGATGGTTGGAGG - Intronic
1110468865 13:75834826-75834848 TCTTAATTATAGAGGCTAGATGG + Intronic
1111004241 13:82228282-82228304 TCTTAAAAAAAGAGGGTGGATGG - Intergenic
1112449412 13:99495410-99495432 GCCTAAATTTAAAGGGTTAAAGG - Intergenic
1117067796 14:52027690-52027712 TCTTTAATTCAGTGGGATGAGGG - Intronic
1119135136 14:72211323-72211345 TCTTGAATTTAGAGACTTGAAGG + Intronic
1119494504 14:75067258-75067280 ACTTAAATTTAGGGAGTAGATGG + Intronic
1121500882 14:94436466-94436488 TATAAAATTTAGATGGCTGAAGG + Intergenic
1122592143 14:102861354-102861376 CCTAAAATTTAGGGGGTTGGAGG - Intronic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1124821353 15:33048999-33049021 TCCTAAATTTAGACGGTTAAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130773838 15:86954775-86954797 TGTTAGATATAGAGGGTTCATGG - Intronic
1133081783 16:3327248-3327270 TTTTGCATTTAGAGGGTTGTTGG + Intergenic
1137452880 16:48593417-48593439 ACCTAAGTTTAGAGGGTTAAAGG + Intronic
1138607947 16:58100507-58100529 TCTTAAAGCTAGAAGGATGAGGG - Intergenic
1147741411 17:42672762-42672784 TCCTAAAGTTAGAGGATTAAAGG - Intronic
1153512031 18:5865454-5865476 GCTTAAGTTTAGAGAGTTAAAGG + Intergenic
1163069377 19:14825698-14825720 TCTTACATTTGGAGGCTTGTTGG - Intronic
1165604344 19:37087609-37087631 TGTTAAAGTAAGTGGGTTGAGGG + Intronic
1167452222 19:49578017-49578039 TCTTAAAATGATAGTGTTGATGG + Intronic
1168127330 19:54292611-54292633 TCTTTATTCTAGAGGGTAGATGG + Intergenic
1168127335 19:54292685-54292707 TCTTTATTCTAGAGGGTAGATGG + Intergenic
1168127344 19:54292796-54292818 TCTTTACTCTAGAGGGTAGACGG + Intergenic
1168173022 19:54602047-54602069 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173031 19:54602158-54602180 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173034 19:54602195-54602217 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173046 19:54602343-54602365 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168488434 19:56785956-56785978 TCTGAAATTTATTGGGGTGATGG - Intronic
929474361 2:42230955-42230977 TAATAGATTTACAGGGTTGAGGG - Intronic
930679511 2:54241470-54241492 TCTTAATTAAAGAGGTTTGAGGG - Intronic
931879394 2:66551965-66551987 TCTTAAATTTTGAGATTAGATGG + Intronic
933120859 2:78536158-78536180 GCTTAAATTTTGAGGCTTTAAGG - Intergenic
935491213 2:103722618-103722640 TCCCAAATTTTGAGGTTTGAGGG + Intergenic
939202752 2:139059167-139059189 ACTTAAATGTAGATAGTTGATGG - Intergenic
939529097 2:143335274-143335296 TTTTTAATTTAGAAAGTTGAAGG - Intronic
940414943 2:153408775-153408797 TGTTAACTTTATTGGGTTGAAGG + Intergenic
940650956 2:156439986-156440008 TTTTGAATTTAGCGGGTTGAGGG - Intronic
941317029 2:164006184-164006206 TCTTAAATTTAGATTATTGTAGG + Intergenic
942051507 2:172145223-172145245 TTTTAAAGTTATAGGGTTGGTGG - Intergenic
942194101 2:173499931-173499953 GCCTAAGTTTAGAGGGTTAAAGG + Intergenic
942651052 2:178168319-178168341 CCTTAAATTTAGGGGGGTCAGGG + Intergenic
943839759 2:192564231-192564253 TATTAAATATAGAGGGGGGAGGG - Intergenic
945788192 2:214271413-214271435 TCATAAATTTAGAGGTTTGTTGG + Intronic
947510954 2:230753960-230753982 TTTAAAATTTAGATGGTTGGTGG - Intronic
1168781254 20:492707-492729 TCTAAAATTCAGGGGGCTGAAGG - Intronic
1170070944 20:12366873-12366895 TAATAAATTTAGAAGCTTGAGGG + Intergenic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1178724086 21:35035937-35035959 TCCTAAACTGAGAGGGTTAAGGG + Intronic
1179119861 21:38533438-38533460 CCTTCATTTTAGAGGATTGAAGG - Intronic
1182929721 22:34161178-34161200 TCAAAAATTTAGGAGGTTGAGGG - Intergenic
949326649 3:2873492-2873514 TCTTAAATTTAGAAGTTTGTGGG - Intronic
949748090 3:7318543-7318565 TTATAAATTTGGAAGGTTGAAGG + Intronic
951552454 3:23887683-23887705 TCTTACCTTTGGAGGCTTGAAGG - Exonic
952830803 3:37563360-37563382 TCCAAAATTTAGGGGGTTGAAGG - Intronic
955711599 3:61784897-61784919 ATTTAAAATTAGAGAGTTGAAGG + Intronic
956561997 3:70588916-70588938 TATTAAATTTGGAGATTTGAGGG - Intergenic
957151060 3:76486903-76486925 TATAACATTTAGAGGGTTTAGGG - Intronic
957278777 3:78123085-78123107 GCTTAAATTTAGAGGATAAAAGG - Intergenic
957348742 3:78995825-78995847 TCTCTAATTTAGGGGCTTGAAGG - Intronic
959773328 3:110125985-110126007 TCTCAAATTTTCAGGGTTCATGG + Intergenic
960514701 3:118590538-118590560 TCTAAGATTTAGGGGGTTAAAGG + Intergenic
962974648 3:140435245-140435267 TCATAAATATAGAGAGTAGAAGG - Intronic
964714049 3:159703267-159703289 TCTTCAATGTAAATGGTTGATGG - Intronic
969158999 4:5239011-5239033 TCTTACATTTTGAAGGATGAAGG + Intronic
969420270 4:7090424-7090446 TCTAAGATTTAGGGGGTTGGAGG - Intergenic
969420279 4:7090459-7090481 TCTAAGATTTAGGGGGTTGGAGG - Intergenic
969420288 4:7090494-7090516 TCTAAGATTTAGGGGGTTGGAGG - Intergenic
969420297 4:7090529-7090551 TCTAAGATTTAGGGGGTTGGAGG - Intergenic
969420306 4:7090564-7090586 TCTAAGATTTAGGGGGTTGGAGG - Intergenic
969420315 4:7090599-7090621 TCTAAGATTTAGGGGGTTGGAGG - Intergenic
971386432 4:26144595-26144617 TCTGGAATTTAGAAGGTTGGAGG - Intergenic
971389949 4:26176397-26176419 TCTTAAAGTAAGGAGGTTGATGG + Intronic
972845743 4:42986970-42986992 TCTTAAATTTTGAGCCTAGATGG - Intronic
976100659 4:81559493-81559515 TATTAAATTAAAAGGGTGGAAGG + Intronic
977568745 4:98609030-98609052 ACTTACATTTAGAGGGTTTCAGG + Intronic
977762447 4:100755741-100755763 TCATGAACTTAGAGGGTAGAAGG + Intronic
978105711 4:104899763-104899785 TCTTAAAATTAGAAGGCTGGAGG + Intergenic
978978941 4:114917840-114917862 TCTCAACTTTACATGGTTGATGG + Intronic
979959132 4:126995076-126995098 CCTTAATTTTAAAGTGTTGAGGG - Intergenic
981239244 4:142455342-142455364 TCTTAGACTTAGAGGGTAGAAGG - Intronic
982042502 4:151409506-151409528 CTTTTATTTTAGAGGGTTGAAGG + Intronic
983632744 4:169866148-169866170 TCTTAAATTCTGAGAGTTTAGGG - Intergenic
984441478 4:179775966-179775988 GCCTAAGTTTAGAGGGTTAAAGG + Intergenic
987081923 5:14432889-14432911 GCTAAAATTCACAGGGTTGATGG - Intronic
988295345 5:29352747-29352769 GCCTAAGTTTAGAGGGTTAAAGG + Intergenic
989446228 5:41532714-41532736 TTTTATTTGTAGAGGGTTGACGG - Intergenic
990220589 5:53584324-53584346 TCTTAAATATATATGGTTGACGG + Intronic
990878403 5:60513217-60513239 TCTTAAATATATAAGATTGAAGG + Intronic
992952585 5:81875003-81875025 ACTTAAATAAAGAGGGTGGATGG + Intergenic
993019600 5:82575877-82575899 TTTTAAATTTGTAGGATTGAAGG - Intergenic
996309578 5:122089462-122089484 TCTTAATTTTAGAGGGGTTAAGG + Intergenic
997545868 5:134706987-134707009 TTTTAAAGTTAGCTGGTTGAGGG - Intronic
1000207284 5:159074554-159074576 GCCTAAATTTAGAGGGCTGCTGG + Intronic
1000452553 5:161407919-161407941 TCTTAAATATACAGGGATGGGGG - Intronic
1001219881 5:169891376-169891398 TCTTATAGTTAGAGGCTTCAAGG + Intronic
1001516616 5:172359737-172359759 TCATATATTTACAGGTTTGAGGG - Intronic
1003315662 6:5009479-5009501 TCTTCAATTTAGAGTATTGTTGG + Intergenic
1005395890 6:25381758-25381780 TCTTTAACTTAGAGGTTTTATGG + Intronic
1005419241 6:25631826-25631848 TCCTGAATTCAGAGGGTTTAAGG + Intergenic
1007644574 6:43369940-43369962 CCCTAAATTAAGAGGCTTGAGGG - Intergenic
1008929699 6:56925752-56925774 GATTAAATTGAGGGGGTTGAGGG - Intronic
1009034410 6:58098969-58098991 TCTTTAATTTACACTGTTGATGG + Intergenic
1009433458 6:63591720-63591742 TCTTAAATTTTCAGTCTTGAGGG + Intergenic
1012711673 6:102615235-102615257 TCCCAAATTTAGAGGATTGAAGG + Intergenic
1013473803 6:110488848-110488870 CCTAAAATTTAGGGGGTTGGAGG + Intergenic
1013529790 6:111008585-111008607 AATTAAATTTAGAAAGTTGAGGG + Intronic
1014163128 6:118193504-118193526 GCCTAAGTTTAGAGGGTTAAAGG - Intronic
1014841724 6:126227617-126227639 TGTTAATTTCAGAGGCTTGAAGG - Intergenic
1015792687 6:136979958-136979980 TCGTAGAACTAGAGGGTTGAGGG - Intergenic
1017400050 6:154050561-154050583 TCATAAACTTAGAGAGTAGAAGG + Intronic
1017519103 6:155186030-155186052 TCTTCCATTTTGAAGGTTGAGGG + Intronic
1018498559 6:164377604-164377626 TCTTCAGTTTGGAGGCTTGACGG - Intergenic
1021005710 7:15392471-15392493 TTTTTAATTTAGATGGTTTATGG - Intronic
1023027036 7:36060286-36060308 TCATAAACTTAGAGAGTAGAAGG + Intergenic
1023276081 7:38519966-38519988 TCTTAGATTCAGAGGGTTCATGG - Intronic
1023344462 7:39257066-39257088 CCTTCCATTGAGAGGGTTGACGG - Intronic
1023585196 7:41722551-41722573 ACTAAGATTTAGAGGGTTAAGGG - Intergenic
1023587656 7:41747902-41747924 GCCTAAGTTTAGAGGGTTAAAGG - Intergenic
1025241539 7:57280598-57280620 TCTTTAATATAGTGGGTTAATGG - Intergenic
1029853880 7:103493643-103493665 GCTGACATTTAGAGGGCTGAGGG + Intronic
1030463758 7:109874151-109874173 TCTTCAAATTAGAAGCTTGAAGG - Intergenic
1031065662 7:117102425-117102447 TCTTCAATCTAGGGGATTGAGGG + Intronic
1031146481 7:118002699-118002721 TTTTAAATTTACAGGGTACAAGG + Intergenic
1032088480 7:128896372-128896394 TCTAATATTTAGAGGGTTAGAGG + Intronic
1034167383 7:149036223-149036245 TGTTAATTTTAGATTGTTGAGGG - Intergenic
1036556102 8:9861919-9861941 CATTCAATTTAGAGGGTTGTGGG + Intergenic
1036944605 8:13082847-13082869 TCTTAAATTTAAACTGATGAAGG - Intergenic
1041762443 8:61381584-61381606 ACTTAAAGTTGGAGGGTAGAAGG - Intronic
1043600103 8:81927304-81927326 TCTTAATTTTAGTGGATTAATGG - Intergenic
1045183189 8:99808825-99808847 TCTTACATTTAAAATGTTGAGGG + Intronic
1046282207 8:112048449-112048471 TCCTTAAGTTAGAGGGTTAATGG - Intergenic
1047141556 8:122146526-122146548 TATTAAATTTGGTGTGTTGAAGG - Intergenic
1053274870 9:36775725-36775747 TTTAAAAATTAAAGGGTTGAAGG - Intergenic
1053867818 9:42458686-42458708 TCTGAGGTTTAGAGCGTTGAAGG - Intergenic
1055497951 9:76874309-76874331 TGTGAAATTCAGAGGGTTGCTGG + Intronic
1056337150 9:85583368-85583390 TCTTACATTTCCAGGGTTGTAGG - Intronic
1059182286 9:112228660-112228682 TAATAAGTTTAGAGTGTTGATGG - Intronic
1060681395 9:125568178-125568200 TCTAAGATTTAGGGGGTTAAAGG + Intronic
1062706327 9:137945685-137945707 GCCTAAGTTTAGAGGGTTAAAGG - Intronic
1186718948 X:12282051-12282073 TCATAAATTAAGAGGTCTGAAGG + Intronic
1189903325 X:45731157-45731179 TCTTCATTTTGAAGGGTTGAAGG - Intergenic
1190137851 X:47813609-47813631 CCTAAGATTTAGAGGGTTAAAGG - Intergenic
1194260254 X:91685666-91685688 TCTTAACTCCAGAGGGTTGGGGG - Intergenic
1195169456 X:102251727-102251749 TCTTAAATATTGAGGGATGAAGG - Intergenic
1195189401 X:102435362-102435384 TCTTAAATATTGAGGGATGAAGG + Intronic
1195532058 X:105968775-105968797 AATGAAATTTAGAGGGTGGAGGG + Intergenic
1195837438 X:109133201-109133223 TGCTAAATTTAGAGGGCAGAGGG - Intergenic
1196058082 X:111377618-111377640 TGTGAAAATGAGAGGGTTGAAGG + Intronic
1196266365 X:113651865-113651887 TACTAAATTATGAGGGTTGAGGG - Intergenic
1196379431 X:115073191-115073213 TCTAAAATTGAGAGTGTTGAAGG - Intergenic
1196455716 X:115890167-115890189 TTTTAAATTTATAGTGATGAAGG - Intergenic
1197035178 X:121865265-121865287 TATTAAATTGAGAGGGATCATGG - Intergenic
1197661338 X:129177229-129177251 TGTTAAATTTAAAGTGCTGAAGG - Intergenic
1200578946 Y:4924724-4924746 TCTTAACTCCAGAGGGTTGGGGG - Intergenic
1201769510 Y:17605776-17605798 ATTTAAAGTTAGAGGGTTGGAGG + Intergenic
1201832044 Y:18300209-18300231 ATTTAAAGTTAGAGGGTTGGAGG - Intergenic