ID: 912188533

View in Genome Browser
Species Human (GRCh38)
Location 1:107310102-107310124
Sequence CCATTTCAAAAAAGAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912188528_912188533 16 Left 912188528 1:107310063-107310085 CCTAACCATAAGGGTGTTGAATG No data
Right 912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG No data
912188523_912188533 30 Left 912188523 1:107310049-107310071 CCCCTTTTAAAATTCCTAACCAT 0: 1
1: 0
2: 2
3: 29
4: 435
Right 912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG No data
912188530_912188533 11 Left 912188530 1:107310068-107310090 CCATAAGGGTGTTGAATGGTCAT No data
Right 912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG No data
912188524_912188533 29 Left 912188524 1:107310050-107310072 CCCTTTTAAAATTCCTAACCATA No data
Right 912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG No data
912188525_912188533 28 Left 912188525 1:107310051-107310073 CCTTTTAAAATTCCTAACCATAA 0: 1
1: 0
2: 5
3: 42
4: 478
Right 912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912188533 Original CRISPR CCATTTCAAAAAAGAGAATG TGG Intronic
No off target data available for this crispr